Transcript asmbl_19233

Sequence
Transcript Sequence for observation asmbl_19233 of TGE0032301:
GACATGCAATTGGCTGAACTCCCGGGGAGGGGCGGGACTCACCGGGTCTGATCCAGTTAAAAAGGTCGGAGCGGGCCTGGGGCCCGTCTCTCGGGTGGAGTCTTCTGACTGCTGGTGGAGCAGGTCTCAGGAATCTCTTCGCTTCAGCTTCAATCATGGCCTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGGGAATGTCTCAAAGTTCGGGGAGAGGTGGCCTCGGACGCCAAGAGCTTTGTGCTGAACCTGGGAAAAGACAGCAACAACCTGTGCCTACACTTCAATCCTCGCTTCAATGCCCATGGAGACGCCAACACCATTGTGTGTAACACCAAGGAAGATGGGACCTGGGGAACCGAACACCGGGAACCTGCCTTCCCCTTCCAGCCCGGGAGCATCACAGAGGTGTGCATCACCTTTGACCAGGCTGACCTGACCATCAAGCTGCCAGACGGACATGAATTCAAGTTCCCCAACCGCCTCAACATGGAGGCCATCAACTACATGGCGGCGGATGGAGACTTCAAGATTAAGTGCGTGGCCTTTGAGTGAAGCCAGCCAGCCTGTAGCCCTCAATAAAGGCAGCTGCCTCTGCTCCCCATAATCCAGCCCTTTCATGGGAGAGTGTTTGTGTGTGTCTATGTGAGGGGCCCCGCCCAACCTGGTCCATCTTCACTTCCATTCATGCCTCCATGTGTTCTTGGTCTCAGTGACCTCTCTTGTGCTTTCCAGGCCAAAGAGAGCCCAGCACAGAGAGGGCTTAAGTGACCACAGAGGGTGAGCCAGTGTCCCACTGTGACAGGGACAGAGCAGTGGGAGGTGGATGGATGAACAGCCGGACCGCATTTGTCTTAATAAAAGCCAGAAACCAC