Transcript asmbl_49787

Sequence
Transcript Sequence for observation asmbl_49787 of TGE0006067:
CGGCGCGCGGCGCGGCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCGCTCGGGCCCCGCCATGGCCGTCACCATCACACTCAAAACGCTGCAGCAGCAGACCTTTAAGATCCGCATGGAGCTTGACGAGACGGTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGACGTGATGCCTTCCCCGTGGCTGGACAGAAACTCATTTATGCTGGCAAGATCCTGAGTGATGATGTCCCTATCAGGGACTATCGCATAGATGAGAAGAATTTTGTGGTTGTCATGGTGACCAAGGCTAAAACCAGCCCAGGCACATCAGTACCCCCAGAGGCTTCACCCACTGCTGCTCCAGAGTCCTCCACGTCCTTCTCGCCAGCCCCTGCTTCAGGCATGTCCCATTCCCCACCTACCGCCAGAGAAGACAAGAGCCCATCGGAGGAATCGGTCCCCACGACATCCCCGGAGTCTGTGTCAGGCTCTGTTCCTTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACACTAGTGACTGGCTCTGAGTATGAGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGGGAACGGGTCGTGGCCGCCCTGAGAGCCAGCTACAACAACCCCCACCGAGCCGTGGAGTATCTGCTCACGGTGAGGTGGGGCTGCTGCCTCCTTGGGAGGCTTTCAAGGAATACCTGGGCTTCAGCACCCTGATGGGTGGTCAGGAAGACAAACCCTGCCCCCCGAAGCCTTTGGGTCATGGTACCAGCCAGGAAAGGCTTCTTGTAGGAGGCCAGACATGGGCAGAGAGGTGGGCCCGTGGAGGGCGGGGCTGACGTCTCACCTGTCTCCTGCCAGAGCTGAGTGTGCAGGAGGGAGGCAGCGGGTGGTCTGTGCATTAGAACTAAATAGGACCCCTGACAGGGAATTCCTG