Transcript asmbl_19017

Sequence
Transcript Sequence for observation asmbl_19017 of TGE0042410:
CCGGAGCCGCCATTGTTCCGCCGGGGGAGGACAGCGGGTCCTGGCGCTGGCGCCCCGACGCCGCTTAGCGGCCGCCTCTGGAGACACTCTGTCCCCGCCGCCCCGTGTCCTCCTGGTGGCGGCGGCGTGAGGCCGGCTGCGGAGACTGGGAACCTTTGGCTCTCCCCGTGGCGGCGGCGGCCCTCTATCCCCTACTCCGGCGTGAGGGTTGGCCGCGATGCGCTCGGCCTGAGGTGTCGCGGCCCTGTCGCCTCCCACGACTGTTCCAGCGGCGGCTCCGCTCCCCGGCGTCATCCCGCGAGTCTCTCTGACGGGAGGGAAGATGGCTGCACGAAGCTGGCAGGACGAGCTGGCCCAGCAGGCCGAGGAGGGCTCTGCCCGGCTGCGGGAGTTGCTCTCGGTCGGCCTAGGTTTTCTGCGCACGGAGTTGGGCCTCGACCTGGGGCTAGAGCCGAAGCGGTACCCGGGCTGGGTGATCCTGGTGGGCACCGGCGCTCTCGGGCTGCTCCTGCTCTTCCTTCTAGGTTACGGCTGGGCCGCGGCTTGCGCCGGCGCCCGCAAGAAGCGAAGGAGCCCGCCCCGCAAACGGGAGGAGGCGGCCCCGCCGACTCCGGCCCCCGACGACCTAGCCCAGCTGAAGAATCTCAGAAGCGAGGAGCAAAAGAAGAAGAACCGGAAGAAGCTTCCTGAAAAGCCCAAACCAAATGGACGGACTGTTGAAGTACCCGAGGATGAAGTTGTTAGAAATCCCCGAAGTATAACTGCAAAACAAGCACCAGAGACAGACAAGAAAAATGAAAAGTCAAAGAAAAATAAGAAGAAATCAAAGTCAGATGCTAAAGCAGTGCAAAACAGTTCACGCCATGATGGAAAGGAAGTTGATGAAGGAGCCTGGGAAACTAAAATTAGTCACAGAGAGAAACGACAACAGCGTAAACGTGATAAAGTGCTGACTGATTCTGGTTCATTGGATTCAACTATCCCTGGGATAGAAAATATCATCACAGTTACCACCGAGCAACTTACAACTGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAGTCTGGAAAAGGAGATTCTACACTGCAGGGTGAGAGAAATTACATGACACTTAACCTGAAGGCCAATCAAAATAGAAACTTTACTACATGTGTCTTTCCTTATATGATGTTAAAGGAAAGAAAAGGGATTAAAGATGTTTTTAATTTCTTAATTAATATGATCATAGTCCAGAGAATTTGAAAAATGGAAAAGGAAGATCATTCACACTCGGAGTTTGGTAT