Transcript asmbl_18820

Sequence
Transcript Sequence for observation asmbl_18820 of TGE0000137:
GGGTGTTCGCCGCACAGCTCCTGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGCGGGCAGGAGGGAGCCGGGGAGCGGGCCAGCGGACCATCTTCACCGCGGTCGGGTCGGCTTGCGGAGCGGGAGGCAGCGGCCGGAGAGCCGGGCGGAACCTGCGGGGGCGGAGGCGGCGGTGGCAGCCGCGGCGCAGGGAGCAGGAACAGGGTCAAGTCCTCCATACCAAGGACCAGGCTAAAACCAGATTACACTGCCCCTCCCTGGGCCCTATTGACTTAAAGCAGCCACTGTAATCATGGGCAATATCTTTGGGAACCTTCTGAAGAGCCTAATCGGCAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCTGCCGGGAAGACCACCATCCTCTACAAGCTGAAACTCGGGGAGATTGTCACCACCATCCCGACCATTGGGTTTAATGTGGAGACAGTGGAATATAAGAATATCAGCTTCACAGTCTGGGACGTAGGTGGCCAGGACAAGATTCGGCCCCTCTGGAGACACTACTTCCAGAACACCCAAGGCTTGATATTTGTGGTTGACAGCAATGATCGGGAGCGAGTGAACGAGGCCCGGGAAGAGCTGATGAGGATGCTGGCGGAGGATGAGCTCCGGGATGCTGTGCTCCTTGTGTTTGCAAACAAACAGGATTTGCCGAATGCTATGAATGCTGCTGAGATCACAGACAAGCTGGGGCTGCACTCCCTGCGTCACCGCAATTGGTACATTCAGGCCACCTGTGCTACCAGCGGGGACGGGCTGTATGAAGGCTTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAGAGCCAGGCAGCCCTCTCTGACTACCCCACCCACTCCTGACACACACCTGCTGTCTCCTTACCCCAATTTTCCCTTCTTCCTCTTGAAAGTGGCCAAGGTCCTGGGTATCATGTCCACATGCCCAGCAAGCGCCTTGCCTTCCTCCTCCTCCTCCTCCTCCCTCCTCCCTCCTCCCTCC