Transcript asmbl_18607

Sequence
Transcript Sequence for observation asmbl_18607 of TGE0036243:
GTCTCACAGGAAATTCTCAGCTCCCAGGCATGGGTCCTTGGGCTTCCTGCCTCGCAAGCGCAGCAGCCGGCATCGTGGGAAAGTGAAGAGCTTCCCTAAGGATGACGCTTCCAAGCCCGTTCACCTCACAGCCTTTCTGGGTTACAAGGCTGGCATGACCCACATCGTCCGGGAAGTTGACAGGCCAGGATCTAAGGTGAACAAGAAAGAAGTCGTGGAGGCTGTGACCATTGTGGAAACTCCCCCAATGGTGGTTGTGGGCATTGTGGGATATGTTGAGACCCCACGAGGCCTCCGGACCTTCAAGACTGTATTTGCTGAGCACATCAGCGATGAGTGTAAAAGGCGCTTCTATAAGAACTGGCACAAGTCTAAGAAGAAGGCTTTCACCAAGTACTGTAAGAAATGGCAGGATGACACAGGCAAGAAGCAGCTGGAGAAGGACTTCAACAGCATGAAGAAGTACTGCCAGGTCATCCGCATCATTGCCCACACTCAGATGCGTCTGCTTCCTCTACGCCAGAAGAAGGCACACTTGATGGAGATCCAGGTGAATGGAGGCACTGTGGCTGAGAAGCTCGACTGGGCCCGAGAGCGGCTGGAGCAGCAGGTTCCTGTGAACCAGGTGTTTGGGCAGGATGAGATGATTGATGTCATTGGCGTGACAAAAGGCAAAGGGTACAAAGGGGTAACCAGTCGTTGGCATACAAAGAAACTGCCCCGAAAGACCCATCGAGGTTTGCGCAAAGTTGCCTGTATTGGAGCCTGGCACCCTGCCCGTGTTGCCTTCTCTGTGGCTCGAGCTGGGCAGAAAGGCTACCATCACCGAACAGAGATTAACAAGAAGATTTACAAGATTGGTCAAGGCTACCTCATCAAGGATGGCAAACTGATCAAGAACAATGCATCTACTGACTATGACTTGTCTGACAAGAGCATCAACCCACTGGGTGGCTTTGTGCATTATGGTGAGGTGACCAATGACTTCATCATGCTCAAAGGCTGTGTGGTGGGGACCAAGAAGCGAGTACTTACTCTTCGTAAGGTGAGACTGATCCTGGGCTCTAACCAGTCATTCTGGGCATGGGGGATCACAGGCCTTGAGCTATGCGGAAATTGGCCTGTCTGGGTATTGAAATCCTGGGGAAGGGTGGACTTTGCATTAGCCTTTTACCCACTCTGTTCTGTGTCAGTGTGGTGGCTGTTTGAGCGGGTGCTAAGTATTTGAACGCTGCTTGTCAGCTGCTAAGCATTCTTTTTGGCCCATAGTCCTTGCTGGTTCAGACCAAACGTCGGGCCCTGGAGAAGATTGACCTGAAGTTCATTGACACCACCTCCAAATTTGGCCATGGTCGCTTCCAGACCATGGAGGAGAAGAAAGCATTTATGGGACCACTCAAGAAAGATCGCATTGCCAAGGAGGAAGGAGCTTGATTCCAGGACCACTTTGTGCAGATGGTGGGGTCTCACCAATAAAATATTTCTACT