Transcript asmbl_49750

Sequence
Transcript Sequence for observation asmbl_49750 of TGE0006056:
GTGAAAGAGTTCTTAGCCAAAGCCAAAGAAGATTTTCTTAAAAAATGGGAAAATCCTGCTCAGAATACAGCCCATTTGGATCAGTTTGAACGAATCAAGACCCTCGGCACAGGCTCCTTCGGGCGGGTGATGCTAGTAAAACACAAGGAGACCGGGAGCCACTTCGCCATGAAGATCCTGGACAAACAGAAGGTGGTAAAGCTGAAACAGATCGAGCACACCCTGAACGAGAAGCGCATCCTGCAGGCAGTCAACTTTCCGTTCCTCGTTAGACTCGAGTTCTCCTTCAAGGACAACTCAAATTTATACATGATCATGGAGTATGTGCCTGGCGGGGAAATGTTCTCACACCTGCGGCGGATCGGAAGGTTCAGCGAGCCCCATGCCCGCTTCTACGCCGCCCAGATCGTCCTGACCTTCGAGTACCTGCACTCCCTTGATCTCATCTACCGGGACCTGAAGCCGGAGAACCTTCTCATCGACCAGCAGGGCTACATTCAGGTTACAGACTTTGGTTTTGCCAAGCGTGTGAAAGGCCGCACCTGGACCTTGTGTGGGACCCCTGAGTACCTGGCCCCTGAGATCATACTGAGCAAAGGCTACAACAAGGCTGTGGACTGGTGGGCACTGGGGGTTCTCATCTATGAGATGGCCGCCGGCTACCCACCCTTCTTCGCTGACCAGCCCATCCAGATCTATGAGAAGATTGTCTCTGGGAAGGTGCGGTTCCCGTCTCACTTCAGCTCTGACCTGAAGGATCTGCTGCGGAACCTACTGCAGGTGGACCTCACCAAGCGCTTTGGGAACCTCAAGAATGGGGTCAATGACATCAAGAACCACAAGTGGTTTGCCACAACTGACTGGATCGCCATCTACCAGAGGAAGGTGGAAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGACACGAGTAACTTTGACGACTATGAGGAGGAAGAGATTCGAGTCTCCATCAATGAGAAGTGTGGCAAGGAGTTTTCTGAGTTTTAGGGGTGTGCCTGTGCCCCCAAGGGTTTTTTCT