Transcript asmbl_18258

Sequence
Transcript Sequence for observation asmbl_18258 of TGE0042337:
GGCGGGAAGGTGACGGCCGGCGCGCAGCCCCGGGCCGCGACGCGATGCCCGGCCGAGCACGAGGAGGACATGTACCGTGCTGCAGATGAAATAGAAAAGGAGAAAGAATTGCTAATACATGAAAGAGGGATATCAGAACCCAGGTTAAGTGTGGCTCCTGAAATGGATATCATGGACTACTGCAAAAAAGAATGGAGAGGAAATACTCAGAAAGCCACATGTATGAAAAAGGGCTATGAGGAAGTGTCTCAGAAATTCACTTCCATAAGGCGAGTCCGTGGTGATAACTACTGTGCACTGAGGGCCACACTGTTCCAGGCCATGAGCCAGCTGGCCGAGCTGCCCCCCTGGCTGCAGGACTTGGAGCTCATACTGTTACCAGAGAAGCTGATAAACAAGTATACCTGGATCAAGCAGTGGAAACTTGGACTGAAATTTGATGGGAAGAGTGAGGACCTGGTTGAAAAAATTAAGGAATCCCTTGCCCTGCTAAGGAAGAAGTGGGTAAGCCTGGCTGCAATGAAAACTGCTGAAGCGAGGCAGACAGCTTGTGATGAGCTGTTCACCAACGAAGAGGAGGAGTACAGCCTCTACGAAGCTGTGAAGTTCCTGATGTTAAACAGAGCCATCGAACTGTACGATGACAAGGAGAAGGGAAAGGAAGTGCCGTTCTTCTCTGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCTCCTGAGGAACCACCTAAACCAGGTGGGACACACGGGGGGCCTTGAGCAGGTTGAGATGTTCCTTCTTGCCTATGCTGTCCGCCACAGCATCCGGGTGTACCGGCTGTCCAAGTATAACACAGAGGAGTTCATCACAGTCTACCCCACTGATCCCCCCAAGGACTGGCCAATGGTGACCCTCATAGCTGAGGATGATCGGCACTATAACATCCCTGTCAGAGTGTGTGAGGAGACCAGTGTGTGAGGGACACACATGTGACTGCCAAGAGATGCGCATGTGCAGCTCCTCCTCTGGGGGCCTCAGATCTGCAGGTCTCCAAGGACAATCTGGGAGAACTCTCGGGCCCCTGGAGCCAACTTTGGACCATTATGTTCTGAAGACTAGCTGTTGATAATGAGAATTAATTAGCCAAGCCTTCACTCCTTGTTCTGTTATGCAGTGTGTTCCACTGGGGGCTTCAGCACGTGCCTTTGGAAGGTGCAAACTATGTCTCCATAAGGCGGATGCTTTTGGGTCAAAGAAAACTGTTTGGAAAGGAATCTGTCCAATGAAAGTTCTGACGGTAAACTGGTTTTACTTCTCTTTTTAAAACAGTAGTTTTGTATTTGATTTTTATTCCCTTTTTG