Transcript asmbl_16894

Sequence
Transcript Sequence for observation asmbl_16894 of TGE0032154:
CGGCAGCAGCGGCGGCGGCGGCCCCGGCCGAGGTGCGCGCTGGTGGGGAGGGGGGGCCTGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGAGCCTGGCCCAACTAGAGAATCTGTGCAAACAGTTGTATGAAACAACAGATACAACCACTCGACTGCAGGCAGAGAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTGCTCCTCGAGAGAGGAAGTTCGTCCTACTCCCAGCTGCTGGCAGCTACATGCCTTACCAAGCTCGTGTCTCGGACAAACAACCCCTTGCCACTGGAGCAGCGGATAGATATCCGGAACTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCAACTTTCGTGACTCAAGCCCTCATCCAGCTGTATGCCAGGATCACAAAGCTGGGCTGGTTTGACTGCCAGAAGGATGACTATGTCTTCAGAAACGCAATCACAGACGTCACAAGGTTCCTGCAGGACAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTCACCAATGAAATTAATCAAGCAGACACAACTCATCCTTTAACCAAACACAGAAAAATAGCCTCTTCTTTCCGAGACTCATCACTGTTTGATATCTTCACACTTTCCTGCAATTTACTAAAACAGGCATCAGGAAAGAATCTGAACTTGAATGATGAAAGTCAGCATGGCTTGCTAATGCAACTGCTCAAACTCACCCACAACTGTCTGAACTTTGATTTTATCGGCACATCTACTGATGAGTCCTCAGACGACCTGTGTACAGTGCAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCGACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATTCCTCCCTCGTTCTCACCTTTGGTATTGTCCTGCTTAGTACAGATTGCCTCAGTCCGGAGATCCCTATTTAACAATGCTGAGAGGGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTCTGCAGACTACTGGCTCGGTTAAAGAGTAACTACCAACTGGGAGAACTGGTAAAAGTGGAAAACTACCCTGATGTTATCCGATTGATAGCCAACTTCACAGTGACCAGCCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTACCATATGTCAAAGCCACAGAGCCCCATATGCTGGAAACATATACTCCTGAGGTTACCAAAGCCTATATCACATCCCGCTTGGAATCTGTGCACATCATTCTGAGGGATGGCCTGGAAGATCCCCTGGAAGATACAGGTCTGGTCCAGCAACAGCTGGACCAGCTGTCCACCATCGGGCGTTGTGAGTATGAGAAGACATGCGCGCTCCTTGTGCAGCTATTTGACCAGTCGGCCCAGTCGTACCAAGAACTGCTGCAGAGTGCCAGTGCCAGCCCAATGGACATTGCAGTGCAGGAGGGACGACTGACGTGGTTAGTCTATATCATTGGAGCTGTGATTGGTGGCCGAGTTTCTTTTGCCAGCACTGATGAGCAAGATGCAATGGATGGTGAGCTTGTCTGTCGGGTGCTCCAGCTTATGAACCTGACAGATTCCCGCTTGGCTCAGGCTGGTAATGAGAAGCTTGAATTGGCCATGCTGAGTTTTTTTGAGCAGTTTCGTAAGATCTACATTGGGGATCAGGTGCAGAAATCCTCAAAGCTGTACCGCCGACTCTCAGAAGTTCTGGGATTGAATGACGAGACGATGGTGCTGAGTGTCTTCATAGGAAAAGTCATCACCAACTTGAAGTACTGGGGTCGTTGTGAGCCAATCACCTCCAAGACACTGCAGCTCCTCAATGACCTCTCCATCGGATACAGTAGCGTAAGGAAGTTAGTGAAGCTTAGCGCTGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACTACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCTCTAACAGCAGCGTTTGAGGCTGTGGCCCAGATGTTCAGCACTAACAGCTTCAATGAACAGGAGGCAAAGAGAACTCTGGTTGGCCTAGTGAGAGACCTGAGAGGGATAGCCTTTGCCTTCAATGCCAAGACCAGTTTCATGATGCTCTTCGAATGGATATACCCCTCCTACATGCCAATTCTCCAGCGGGCAATTGAGCTCTGGTACCATGACCCAGCCTGTACCACTCCTGTGCTCAAGCTGATGGCTGAATTAGTTCATAACAGATCTCAGCGACTCCAATTTGATGTTTCATCTCCCAATGGTATCTTACTTTTCCGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTGCCAAAGGATCAGGTCTATGCTTTGAAGCTCAAGGGTATCTCCATCTGCTTCTCCATGCTGAAGGCTGCCCTCAGTGGGAGTTATGTCAACTTTGGGGTCTTCCGTCTCTATGGAGATGATGCCTTGGAAAATGCCCTACAGACCTTCATCAAACTACTCCTCTCTATTCCTCATAGTGACCTCCTGGATTACCCCAAGCTCAGCCAGTCTTACTACTCACTACTGGAAGTCCTGACCCAGGACCATATGAACTTTATTGCAAGCCTGGAACCTCATGTCATCATGTACATCCTCTCTTCTATTTCTGAAGGACTTACTGCACTTGACACCATGGTATGCACGGGCTGCTGTTCCTGCCTAGACCATATTGTGACGTATCTCTTCAAACAGCTGTCACGGAGCACCAAGAAAAGGACAACACCCCTGAACCGGGAGAGTGACTGCTTTCTGCATATCATGCAGCAGCATCCAGCTATGATCCAGCAGATGCTGTCCACGGTGCTGAACATCATTATCTTTGAAGATTGTAGGAATCAGTGGTCTATGTCTCGACCCCTGCTTGGCTTAATACTGCTTAATGAAAAGTATTTTTCTGACCTAAGAAACAGCATCGTCAATAGCCAACCACCAGAGAAACAGCAGGCCATGCATCTGTGTTTTGAAAATTTGATGGAAGGCATTGAACGGAATCTTCTGACGAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAGGTCAACGACTCAATGAAGAATTCCACTTATGGAGTGAATAGCAATGACATGATGAGCTGACAACTCTCGGACTCTACCTTGCAGAGCAGCGTCCCTTTGGTCTGGTCCAGAGGGTGAACAGTTGCAAGGGAGAGA