Transcript asmbl_16757

Sequence
Transcript Sequence for observation asmbl_16757 of TGE0032142:
CGCTCATTCAAAGTCCGGGGGAGCGACCTGGGAAGCGGAATTCGGGGCCTGAACCTCCGTGCCTTGACCTACTGATTGTTCCCTTTGCAGACCCTGCCTTCCTCTCAGTCCACACTCCGAGCCGTAGACGTCGGGTTTCCAGCTCCGTCTGTGCACACATAACTCCAGGAAGCCGCTAGCTCCCGACGATGTCTTCTGTCAAGTTATGGCCTACTGGTGCGTCAGCGGTTCCTCTGGTGAGCCGTGAAGAACTGAAGAAGCTGGAGTTTGTGGGTAAAGGAGGGTTCGGAGTCGTGTTCCGGGCACACCACAGAACATGGAACCATGATGTAGCAGTCAAGATCGTGAACTCGAAGAAGATATCCTGGGAGGTGAAGGCTATGGTTAATCTTCGTAATGAGAACGTTCTGCTCCTGCTGGGGGTCACTGAGGACCTCCAGTGGGACTTCGTGTCCGGGCAGGCTCTGGTGACAAGATTCATGGAGAATGGCTCCCTCGCAGGGCTGCTGCAACCCGAGTGCCCTCGGCCCTGGCCACTCCTCTGTCGCCTGCTGCAGGAAGTGGTGCTGGGGATGTGCTACCTACACAGCTTGAACCCTCCGCTCCTGCACCGGGACCTCAAGCCCTCTAACATTCTGCTGGATCCAGAGCTCCACGCCAAGCTAGCAGATTTTGGCCTGTCCACGTTTCAGGGAGGGTCCCAGTCAGGGTCAGGATCAGGATCAGGATCCAGGGACTCTGGGGGCACCCTAGCGTACTTGGACCCAGAGCTGTTATTTGATGTCAACCTGAAGGCTTCTAAAGCGAGTGATGTCTACAGCTTTGGGATCCTCGTGTGGGCAGTGCTGGCTGGCAGAGAAGCTGAGTTGGTAGACAAGACTTCACTAATCCGGGAAACAGTGTGTGACAGGCAGAGTCGTCCTCCACTGACAGAGCTGCCTCCAGGTAGCCCTGAGACTCCCGGCTTGGAAAAACTGAAGGAGTTAATGATTCATTGCTGGGGTTCCCAGTCCGAAAACAGGCCATCCTTCCAGGACTGCGAACCAAAAACCAATGAAGTTTACAATCTGGTAAAGGACAAGGTAGATGCTGCTGTCTCCGAGGTAAAGCATTATCTGTCTCAGCACAGAAGCAGCGGCAGAAACTTGTCTGCCAGAGAGCCAAGCCAAAGAGGCACAGAAATGGATTGCCCGAGGGAAACCATGGTTTCTAAAATGCTGGACCGCCTGCATTTGGAGGAACCCTCCGGACCAGTTCCTGGAAAATGTCCTGAGAGGCAAGCACAGGACACATCAGTTGGGCCTGCCACACCAGCAAGGACATCTTCTGACCCCGTGGCTGGCACTCCTCAGATTCCACATACTTTACCCTTCAGAGGCACAACACCTGGGCCAGTCTTTACTGAGACTCCCGGTCCTCACCCCCAAAGGAATCAGGGAGATGGAAGACACGGCACTCCTTGGTATCCCTGGACCCCACCGAATCCAATGACAGGGCCACCGGCTCTCGTCTTCAACAACTGTTCTGAAGTGCAGATTGGGAACTACAACTCCTTGGTAGCACCACCAAGAACTACTGCCTCAAGTTCGGCCAAGTATGACCAAGCACAGTTCGGCAGGGGTAGGGGCTGGCAGCCCTTCCACAAGTAGACTTCAGAGAATCACTGCAAGAGCCTGAAGTGTGCCATTCAGCGTGGCAATAAAAAGCACGTTTTAAGCAACCTGGACTGGCTAAGACAGTCCTTGCCACTTCCTGAAGCTCACAACATTCTGTGAGGACAGTTGGACCTACACCCAAACTGACTCTTGACCCATCTCCTTAAAGTCAATAAACATAGCATGTTAACTGTGA