Transcript asmbl_16753

Sequence
Transcript Sequence for observation asmbl_16753 of TGE0042305:
CGGAGTTGCACGTCCTGGCACCTCCTCCCTGAGCAGATTGAACGGGCTGCCTCCGGACCCCTCCCCTATCGCCAACGCTGAGCCGAAACCATGCATGGGCGCCTGAAGGTGAAGACGTCCGAAGAGCAGGCAGAGGCCAAAAGGCTAGAGCGGGAACAGAAGCTAAAGCTCTACCAGTCAGCCACTCAAGCTGTCTTCCAGAAGCGGGAGGCAGGCGAGCTGGATGAATCCGTCCTAGAACTGACAAGCCAGATTCTGGGAGCCAACCCTGATTTTGCCACCCTCTGGAACTGTCGCAGAGAAGTGCTCCAGCAGCTAGAAACCCAGAAGTCCCCTGAGGAGTTGGCTGCTCTTGTGAAGGCAGAACTAGGCTTCCTTGAGAGCTGTCTGCGTGTGAACCCTAAGTCCTATGGCACTTGGCACCACCGCTGCTGGCTGCTGAGTCGCCTGCCTGAGCCCAACTGGGCCCGGGAGCTGGAGCTGTGCGCTCGCTTCCTCGAGGCCGATGAGCGGAACTTTCATTGCTGGGACTATCGGCGATTTGTAGCTGCACAGGCTGCTGTCGCGCCTGCAGAGGAACTAGCCTTCACTGACAGCCTCATCACCCGGAACTTCTCCAACTATTCTTCCTGGCATTATCGCTCCTGCCTCTTGCCCCAGCTGCACCCCCAGCCAGACTCTGGCCCCCAGGGACGGCTCCCTGAAAATGTACTGCTGAGAGAGCTGGAGTTGGTGCAGAATGCCTTCTTTACTGACCCCAATGATCAGAGTGCCTGGTTCTATCACCGCTGGCTCCTGGGGCGGGCGGAGCCCCACGATGTTCTGTGCTGCCTGCATGTGAGCCGGGAAGAGGCCTGTCTGTCAGTCTGCTTTTCTCGTCCCCTGATAGTGGGCTCCAAGATGGGGACCTTGCTACTCACGGTTGACGAGGCACCTTTGAGTGTGGAATGGAGGACTCCAGATGGCAGGAACCGGCCCAGCCATGTCTGGCTCTGTGACCTGCCTGCTGCCTCTCTCAATGACCACTTGCCCCAGCACACGTTTCGTGTCATCTGGACAGGAAGCGATACCCAGAAGGAGTGTGTGCTTTTAAAAGGTCACCAGGAGTGCTGGTGCCGAGACTCAGCCACTGATGAACAGTTGTTCAGGTGTGAGCTGTCCGTGGAGAAGTCCACAGTGCTACAGTCCGAGCTTGAGTCCTGTAAGGAGCTGCAGGAACTGGAGCCTGAGAATAAATGGTGCCTGCTGACCATCATCCTCCTGATGAGGGCACTGGACCCCCTCCTCTACGAGAAAGAAACACTGGAGTACTTCAGTACCCTCAAAGCTGTGGACCCGATGAGAGCAGCCTACTTGGACGACCTGCGCAGCAAGTTCTTGGTGGAAAACAGTGTTCTCAAGATGGAGTATGCTGACGTGCGTGTGCTGCACCTGGCTCACAAGGTATGGGCTCAGCATGGGCCCCTTCCTCCTGCTGTCTTTCCCACCAGGTTGACCATACCGTCT