Transcript asmbl_16732

Sequence
Transcript Sequence for observation asmbl_16732 of TGE0032163:
GTCTGGGCCTGGAGAGTGAAAGCGAAAGCTGGGGCTGCTAGCCCAGGCTCGAGAGCTGCCAAGTGGGGGGAAGCATGGCCAAGCCTTGTGGGGTCCGCTTGAGTGGAGAAGCCCGAAAACAGGTGGATGTCTTCAGACAAAATCTTTTCCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCCCTGAGTCAGCTCTTGCAGGAGGATTCCCTCAATGTGGCCGACCTCTCCTCCCTCCGGGCTCCTCTGGACATCCCTATCCCAGATCCTCCACCCAAGGATGACGAGATGGAAACAGACAAGCAGGAGAAGAAGGAAGTCCCTAAGTGTGGCTACCTCCCGGGGAACGAGAAGCTTCTGGCCTTGCTCGCTTTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAGAAGTGCATTCTGGTAATCACATGGATCCAGCACCTGATCCCCAAGATTGAGGATGGAAATGATTTTGGGGTGGCAATTCAGGAGAAGGTGCTGGAGAGAGTGAATGCTGTCAAGACCAAAGTAGAAGCTTTCCAGACAACCATTTCCAAGTACTTCTCAGAACGAGGGGACGCTGTAGCCAAGGCTTCCAAGGACACCCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAAGCAGCCTATGGGGCGCTTAGGGCCATGGTGCTGGACCTGAGGGCCTTCTATGCTGAGCTTTATCATATCATCAGCAGCAACCTAGAGAAAATCGTCAACCCGAAGGGTGAAGAAAAGCCATCGATGTACTGAGCTAAGGATTAGAAGGAAAATAAATGATTTATACTTTA