Transcript asmbl_16686

Sequence
Transcript Sequence for observation asmbl_16686 of TGE0042290:
CCGCGCTGCACCTCGGTCTGTTGACTTCACTTTTGCGTCCTCGGTTGCCCTTCCTCCCGCCACCCTACGGAACGAGCGGTGGGTTTGGTTTTTTCGCTTTTTAAATCTTCGACGCTCTAGGGACCCGGAAGCGGAAGGGGATACCGGGCGGTCGGTACTTCCGGGTCACAGAGAGTGCGGGATTCCGGGCCGAGCGCGGGTGGCGGAGCTGGGACCTCGCGTGATTCTCGGAGCCCGACGGGAAGCGGCGTCCAGGGCAATGGCTGTGACTCTGGACAAAGACGCGTACTACCGGCGAGTGAAGAGATTGTACAGTAACTGGCGGAAAGGAGAAGATGAGTATGCCAGTATTGATGCCATTGTTGTATCGGTGGGTGTTGATGAAGAAATTGTGTATGCCAAGTCAACTGCCTTACAGACGTGGCTCTTTGGTTATGAACTAACTGATACAATCATGGTCTTCTGTGATGACAAAATCATCTTCATGGCCAGCAAAAAGAAGGTGGAGTTTCTGAAACAGATTGCCAATACTAAAGGCAATGAGAATGCTAATGGAGCCCCTGCCATCACACTGCTTGTCAGAGAGAAGAATGAAAGTAACAAGAGCAGCTTTGACAAAATGATTGACGCTATCAAAGAAAGCAAGAGCGGCAAGAAGATCGGAGTGTTCAGCAAAGACAAGTTCCCTGGAGAGTTCATGAAGAGCTGGAGTGATTGTCTCAACAAGGAGGGCTTTGACAAAGTAGACATCAGCGCTGTTGTGGCATACACCATTGCTGTGAAAGAGGACGGTGAGCTCAACCTGATGAAGAAAGCAGCCAGCATCACCTCTGAGGTCTTCAACAAGTTCTTTAAGGAAAGAGTCATGGAAATAGTGGATGCAGATGAGAAAGTTCGGCATAGCAAATTGGCTGAGTCTGTGGAAAAGGCCATTGAAGAAAAAAAATACCTAGCTGGGGCAGATCCTTCTACTGTGGAAATGTGTTACCCTCCTATCATTCAGAGTGGTGGCAACTATAATCTCAAGTTCAGTGTGGTGAGTGATAAGAATCATATGCATTTTGGGGCCATTACGTGTGCCATGGGCATTCGCTTTAAATCTTACTGCTCCAACCTTGTTCGCACTCTGATGGTTGACCCCACTCAGGAAGTTCAAGAAAATTACAACTTTTTACTTCAACTTCAAGAGGAGTTGCTAAAGGAATTAAGACATGGTGTGAAGATATGTGATGTGTATAACTCTGTCATGGATGTGGTTAAGAAGCAGAAACCAGAATTGCTGAACAAAATTACAAAGAATCTAGGATTTGGGATGGGAATTGAATTCCGTGAAGGCTCTCTAGTAATCAATAGTAAAAATCAGTACAAGCTAAAGAAAGGGATGGTTTTTAGCATCAATCTAGGATTTTCAGACCTGACTAACAAAGAAGGGAAAAAGCCAGAAGAGAAAACCTATGCCCTGTTCATTGGTGACACGGTGCTTGTAGATGAGGATGGTCCAGCCACTATTCTTACTTCTGTGAAAAAGAAAGTAAAGAATGTGGGGATTTTCCTGAAGAATGAGGATGATGAAGAGGAGGAGGAAGAGAAAGATGAGGCAGAGGACCTTTTGGGAAGAGGCTC