Transcript asmbl_16685

Sequence
Transcript Sequence for observation asmbl_16685 of TGE0042289:
CAGAGGACCTTTTGGGAAGAGGCTCTAGGGCGGCATTACTTACTGAAAGAACAAGGAATGAGATGACTGCAGAAGAGAAGCGAAGAGCACATCAGAAGGAACTGGCAGCACAGCTCAACGAGGAAGCGAAGAGGAGGCTGACAGAGCAGAAAGGGGAACAGCAGATTCAGAAAGCTCGAAAATCTAATGTGTCCTATAAAAACCCATCTCTGATGCCTAAGGAACCACATATTCGGGAGATGAAGATCTATATTGATAAGAAATATGAGACTGTGATAATGCCTGTGTTTGGCATTGCCACACCCTTCCATATTGCCACAATCAAGAACATAAGTATGTCTGTCGAAGGAGACTATACTTACTTGCGAATCAACTTCTATTGTCCAGGCAGTGCTCTGGGCAGGAATGAGGGCAACATCTTTCCTAACCCTGAAGCCACTTTTGTCAAGGAAATTACATACCGAGCTTCAAATATGAAAGCACCTGGAGAGCAGACTGTACCCGCCTTAAATCTTCAGAATGCGTTCCGAATTATAAAAGAAGTACAAAAACGTTACAAGACCAGAGAAGCTGAAGAGAAAGAAAAAGAGGGCATTGTAAAACAAGACTCGCTGGTGATCAACCTAAACCGGAGTAATCCAAAACTGAAAGACCTGTACATTCGTCCAAACATTGCCCAGAAGAGAATGCAGGGCTCACTGGAGGCTCATGTCAATGGTTTCCGATTCACATCTGTTCGAGGAGACAAGGTGGATATTCTGTACAATAATATCAAGCATGCGCTGTTCCAGCCCTGTGATGGCGAGATGATTATTGTTTTGCACTTTCACCTCAAGAATGCTATCATGTTTGGGAAGAAGCGACACACAGATGTACAGTTCTACACAGAAGTTGGAGAGATCACTACAGATTTGGGGAAACATCAACACATGCATGACCGAGATGACCTGTATGCTGAGCAGATGGAACGAGAAATGAGACACAAACTGAAAACGGCCTTTAAAAATTTCATTGAAAAAGTAGAGGCCCTAACAAAGGAGGAGCTGGAGTTTGAAGTGCCATTTAGGGACCTGGGGTTTAATGGGGCTCCCTACAGGAGTACCTGCCTCCTTCAGCCCACTAGTAGTGCCCTGGTAAATGCTACAGAGTGGCCACCCTTTGTGGTGACACTGGATGAAGTGGAGCTGATCCATTTTGAGAGGGTCCAGTTTCACCTGAAGAACTTTGATATGGTCATTGTCTACAAGGATTACAGCAAGAAAGTCACGATGATCAATGCTATTCCTGTTGCCTCTCTAGACCCCATCAAGGAGTGGCTGAATTCCTGTGACCTAAAGTACACAGAAGGAGTTCAGTCTCTCAACTGGACTAAAATCATGAAGACCATTGTTGATGACCCCGAGGGCTTCTTTGAACAAGGTGGCTGGTCCTTCCTGGAACCTGAGGGTGAGGGGAGTGACGCTGAGGACGGAGACTCGGAGTCTGAAATTGAAGATGAGACTTTCAATCCTTCTGAAGATGACTATGAAGAGGAAGAAGAGGACAGCGATGAAGATTACTCATCAGAAGCTGAAGAATCAGACTATTCTAAGGAATCTCTGGGAAGTGAAGAAGAAAGCGGGAAGGACTGGGATGAGCTAGAAGAAGAAGCACGAAAAGCGGACCGGGAAAGCCGTTATGAGGAGGAAGAAGAACAGAGCCGAAGTATGAGCCGGAAGAGGAAGGCATCTGTACATAGTTCAGGCCGTGGCTCTAACCGTGGTTCCAGACACAGCTCTGCACCCCCGAAGAAAAAGAGAAAGTAATATGAACCTTGGGTCCTATGCTCCATTCTTTATGCAGACAACTCCTAAAATGACATGACATAGAAACTGTTTTTCCTTTTGGTTTCGTTGAAGTTTTGCCATTTGTGTTTATGGGTTTAGGGGCCATTTGTGCGGACCAAGCTACTCGGGGAATTCCAGGCCCACCAGGACATGTGCCAGTGGCCCCGATCAGATGGCTGGCAAGGGAGGCGGTGTTGAAGGGCAGGAGGCTCCTCCCACTGTTGATCCCATTGCCTCTTTTCTTCTGACAACTTACCTTTGGTGTCTGAAAGCTGAATTCCCAAGACAGTGAGAGACTCTGACCACTAACCATTTCTAGGATTCTTTTTTCTTTACTTTTTTATTTTTCCTGTTTTGAGACAGTCTTGCTATGCAGCCATGGCTTACCTTGAAGTCACTGTAAGCCAGGCTAGCCTCAAATGTATGATCCTCTCGCTCTGCCTCCCAAGTGCTAAGGCTACAGGCTTGAGTCACTGTACTTAGACGAAGCATAGTTCTGGCCCAGAGTCAGTCCTCCGTCCGTCCCTTTATCAGTTCCAGATCTGCAGTTCTCAAGAACGTCCTTGGGCTCTGCTGATGACTGTGACTTGGCTGAGCTGGGCTGGTGTCTGGTCTTCAGTGGTTCTGGTTTCTTGCCTCATGCACATTCTGGGGTTGTTTTTGCTGCATCAGAAGACAAACACTGGCACTCGTGGCTGTTTTT