Transcript asmbl_16513

Sequence
Transcript Sequence for observation asmbl_16513 of TGE0042272:
CGCCCCCACCGCCCCCTCTCGGGGCCGACCGCGTCGTCAAAGCTGTTCCTTTTCCCCCAACTCATCGGCTGACATCTGAAGAAGTGTTTGATATGGATGGGATACCCAGGGTTGATGTTCTGAAGAACCACTTGGTAAAAGAAGGGCGGGTGGATGAAGAAATTGCACTAAGAATTATCAATGAGGGTGCTGCCATACTTCGGCGGGAGAAAACCATGATAGAAGTAGAAGCTCCAATTACAGTGTGTGGTGACATCCATGGCCAATTTTTTGATCTGATGAAACTTTTTGAAGTAGGAGGATCACCTGCTAATACACGATACCTTTTTCTTGGTGATTATGTGGACAGAGGTTATTTTAGTATAGAGTGTGTCTTATATTTATGGGTCTTGAAGATTCTATACCCAAGCACATTATTCCTTCTGAGAGGCAACCATGAATGCAGACACCTTACTGAATATTTTACCTTTAAGCAGGAATGTAAAATTAAATATTCAGAAAGAGTCTATGAAGCTTGTATGGAGGCTTTTGACAGCTTGCCCCTTGCTGCACTTCTAAACCAACAATTTCTTTGTGTTCATGGTGGACTTTCACCAGAAATACACACACTGGATGATATTAGGAGATTAGATAGATTTAAAGAGCCACCTGCATTTGGACCAATGTGTGACTTGCTATGGTCTGATCCTTCTGAAGACTTTGGAAATGAAAAATCACAAGAACATTTTAGTCATAATACAGTTCGAGGATGTTCTTATTTTTATAACTATCCAGCAGTGTGTGAATTTTTGCAAAACAATAATTTGTTATCGATTATTAGAGCTCATGAAGCTCAAGATGCAGGCTATAGAATGTACAGAAAAAGTCAAACTACAGGGTTTCCTTCATTAATAACAATTTTTTCGGCACCTAATTACTTAGATGTCTACAATAATAAAGCTGCTGTACTAAAGTATGAAAATAATGTGATGAACATTCGACAGTTTAATTGCTCTCCACATCCTTATTGGTTGCCCAATTTTATGGATGTCTTTACATGGTCTTTACCATTTGTTGGAGAAAAAGTGACAGAAATGTTGGTAAATGTTCTGAGTATTTGTTCTGATGATGAACTAATGACAGAAGGTGAAGACCAGTTTGATGGTTCAGCTGCAGCCCGGAAAGAAATCATAAGAAACAAGATCCGAGCAATTGGCAAGATGGCAAGAGTCTTCTCTGTTCTCAGGGAGGAGAGTGAAAGCGTGCTGACACTCAAGGGCCTGACTCCCACAGGGATGTTGCCTAGTGGAGTGTTGGCTGGAGGACGGCAGACCTTGCAAAGTGCAATACGAGGATTCTCTCCACCACATAGAATCTGCAGTTTTGAAGAGGCAAAGGGTTTGGATAGGATCAATGAGAGAATGCCACCCCGGAAAGATGCTGTGCAGCAAGATGGTTTCAATTCCCTGAACACCGCACATACCACTGAGAACCACGGGACTGGCAACCATAGTGCCCAGTGACCAGCGGCTTCCCAGGGACTCTCACATCTTGGGCCCCAAATGGACAGATCACTTCAAGGAGCTGGAGGGGTTGACCAAGGTGATGATAAATGTCATAATCTCTCTGAAGAAACCATTGTGCTTTCTGAGATCCGTGCCCCCTTCCTGGATGGAGGCTTGAGGGCCCTGGGACTTGTGCCGTCTATAAGATTGGGTAATCGCTGCCACAGAGGAGAGCAGTGAGCAAGGGGCTTGGGGCAATTTCCAGTGGAGGATATCTACACCTCCATTTATGCTTGTGGTTCACACATTTACGTTTACAAATGAGATTTCCTTTGTTTTTCCCCTCAGTAGAATTAGACATTTTTCAACCATGACTTTAAATACAATCTTTAGAGATAACGTGGAACTCCCCCCATCACCCTCACCCCATGAAATGTCTTTAAAAGGATGGATTAGCATGGTCTTAAAATATATTTCTGAGGTTACTAGATGTATTTTGACTTGTAGACAAAATCTGAGAAACCCAGTTGGTGTTTATATAAAATGCTGACCTCAGGTTATAGTTCTTAAATGTGGCTAATTCTGTAACATAGTCTTGGTATTTTTCAATTATGAATGCATAAACTATTTCTAAGAAGACTCTTACTTGAACAAAATCCAAAAACCAATTTAGATTCTTTTTTGCCCATATCTTTTGTGATTTACACCCCAGAGATTTAAGGAAAAAACAAAAACAAAACAA