Transcript asmbl_15610

Sequence
Transcript Sequence for observation asmbl_15610 of TGE0042259:
GAGGCAGTGCTCGGGGCGGAAGCCCCAACCTTCTTCCCTGGCGAGTTAGAAGCTGCCCCTCACCGAGGAGGAGAATGGCGCTCAAACAGATTTCCAGCAACAGGTGCTTTGGCGGGCTCCAGAAAGTTTTCGAACATAGCAGTGTTGAGCTGAAATGTAAAATGAGATTTGCTGTCTACCTACCACCCCAGGCCGAGAGTGGAAAGTGTCCAGCGCTTTACTGGCTGTCTGGTTTAACTTGCACAGAACAAAATTTCATATCAAAGTCTGGCTATCAGCAAGCTGCCTCAGAGCACGGCCTTGTGGTCATTGCCCCTGATACCAGCCCTCGTGGCTGCAATATCAAAGGAGAAGATGACAGCTGGGACTTCGGCACTGGTGCTGGGTTTTATGTGAATGCCACTGAAGATCCTTGGAAAGCTAACTACAGAATGTACTCTTACGTCACCGAGGAGCTTCCACAACTCATAAATGCCAATTTCCCAGTGGACCCACAGAGGATGTCTATTTTTGGTCACTCCATGGGAGGCCACGGAGCTCTGATTTGTGCTTTGAAAAATCCTGGAAAATACAGATCTGTGTCAGCATTTGCTCCAATTTGCAACCCTGTGCTGTGTTCTTGGGGCAAAAAAGCTTTTAGTGGATATTTGGGACCAGATGAAAGTAAATGGAAGGCATACGATGCGACCTGTCTCGTGAAGGCCTATTCGGGTTCCCAGATTGACATCCTAATCGATCAAGGAAAAGATGACGAGTTTCTTTCAAATGGGCAGTTACTCCCTGATAACTTCATAGCTGCCTGCACAGAGAAGAAAATCCCTGTTGTGTTTAGACTACAAGAGGGTTATGATCATAGCTACTACTTCATTGCAACTTTCATCGCTGACCACATCAGACACCATGCTAAGTACCTGAATGCATGAAAAGCCTCAGCCAAGAGAATCTCATCAGGAGGCCGGAAGGGAATCAACAGGAGTGCTGACTTCCTCGCAGAAGATCATGCTCCTGCAGCTGAATCGCTTTTCTGAATAAATATATCAAACTTT