Transcript asmbl_15489

Sequence
Transcript Sequence for observation asmbl_15489 of TGE0042252:
GCCTCCTTTTTAAGCGCCTCCCGCCCAACCTCAACTCCCTCTGGCTTTGCTATGCTCCTTCCTTCCCCGCCTTCCTTGTCTCCCCGACTGCGCTCGTTCCTGTGGCCATCCCGCAGCGCCAGTCCAGGTGCCATGGCTGCTATGTACCTCCCCGGCCTGCGGCTTAGCCGGCACGGGCTAAGGCCCTGGTGCTGGTCACCGTGCCGTAGCATCCAAACCCTGCATGTGCTCAGTGGAGATATGAGTCAGCTGCCGGCTGGAGTTCGAGACTTTGTGGCGCGCAGTGCGCATCTGTGCCAACCAGAGGGCATCCACATCTGTGATGGGACCGAGGCTGAGAACACTGCCATACTGGCCCTGCTGGAAGAACAGGGTCTTATCCGCAAACTCCCCAAGTATAAGAACTGCTGGCTGGCCCGCACAGACCCCAAGGATGTGGCACGGGTAGAAAGCAAGACGGTGATTGTAACTCCTTCGCAGCGGGACACAGTGCCTCTCCTGGCTGGTGGGGCCAGGGGGCAGCTGGGCAACTGGATGTCCCCAGATGAGTTCCAGAGAGCTGTGGACGAGAGATTCCCAGGATGCATGCAGGGCCGCATTATGTATGTGCTTCCATTCAGCATGGGTCCCGTGGGCTCCCCACTCTCCCGCATTGGAGTGCAGCTCACTGACTCGGCTTACGTGGTGGCCAGTATGCGTATTATGACCCGCCTGGGGACACCTGTACTTCAGGCCCTGGGAGATGGTGACTTCATCAAGTGTCTGCATTCAGTGGGCCAGCCCCTGACTGGACATGGTGAGTACCTATCTAGGACACTGAGACCTTCTTCCACTCAGAGGGAGTCCCAAATCTTACCCATCCACGGAGAAATTGTGGATGTAGAACGATTATTCCCCGAGGCCCAGTGACGCATTCTGGACTGGAGTAACACCATTTGGAGAACAGAAGTCAGTCGACAGGTCTGACAAAGCACGAGGGCTGATGG