Transcript asmbl_15283

Sequence
Transcript Sequence for observation asmbl_15283 of TGE0032038:
CCAGGCTTGCGGCGGGGCGCAACGGTGTCTCCTTCACTTCGCCCTCCAGCCGCGGTGGCTGCAGCGCAACTTTCAGATAGCGGAGTGGCCTCAGCTGCGAGCCGAGCGGTGGCGGCAGCGCCCCTCAGGACACCCGCAGATCACCTTTTCCCCGCGACTTCGCCATGGCTGAGTGCTGTGTACCGGTATGCCCACGGCCGATGTGTATCCCTCCACCCTATGCTGACCTCGGCAAAGCTGCCAGAGACATTTTCAACAAAGGATTTGGCTTTGGGCTGGTGAAGCTGGATGTGAAGACGAAGTCATGCAGCGGTGTGGAATTTTCAACATCTGGCTCATCTAATACAGACACTGGTAAAGTTAGCGGGACCTTGGAGACCAAGTACAAATGGTGTGAGTATGGTCTGACTTTCACAGAGAAGTGGAACACCGATAACACTCTGGGGACAGAGATTGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACTTTTGACACCACCTTTTCACCGAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTGCTTACAAGAGGGAGTGTATAAACCTCGGCTGTGATGTTGACTTTGATTTTGCTGGACCTGCCATCCATGGGTCAGCTGTCTTTGGTTACGAGGGCTGGCTTGCTGGGTACCAAATGACCTTTGACAGTGCCAAGTCAAAGCTGACAAGGAGTAACTTTGCAGTCGGCTACAGGACTGGGGACTTCCAGCTACACACAAATGTAAATAATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTATGTGAAGATTTTGACACTTCAGTAAACCTCGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATACCAGTTGGATCCTACTGCTTCTATCTCTGCAAAGGTCAACAACTCTAGTTTAATTGGAGTGGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTGTCTGCTCTGGTAGACGGGAAGAGCTTTAATGCTGGAGGCCACAAACTTGGGCTTGCCTTGGAATTGGAGGCTTAATCCAGTTAAAAGAAACCTCTGGGAACGAATATCAGAAGATTTGGCCTTAATATATTTCCATGCGACCAGCAGGCTCCCCTTCCTTCCCCCAGAAGGTGATCACATCAAAGGATGATGAAGCAAGAGCTGTATTTTAAATATTTAGACAGTCACTGTTGGCTGGTTCCTAGTTGGATGGTTATCAGTGCTGCCGTGGTGCGGCCCCCTATACATTATTTAAATGTATTTAACTGTTAAATGTGCTACCCACCAATGATGAAATAGACGTTTATGAAAACCGTGCCATGGTGTGCATGTTTGTTTTATGTTCCTTTTAACATTGACTATTGTACTGAATGAGATGGATCAGTGGCTGTTTTAAGATGAGGTAAAAGATTTTTTTTTGTTATATTCACCCATCATTAGAATTACTTTGGTAACCCCAAACATGACAAATTATGAATAAAACAAGTGTACATAACTAATGGCTCACGTATGTGCAGTTACAGATTGCCAGCCTAGGGTCTAATCTTCTTGGCAAATACTTTTTTCTGGTGAGCATTTTGCTCTTTACCTAAACCTGTGCAACCAAATTCCTTGTGTCCCTAGCATAATCCACGAGGTCTTTGAGATTACAATAAAATACAAGGATACATACTTTAA