Transcript asmbl_15248

Sequence
Transcript Sequence for observation asmbl_15248 of TGE0032032:
CCCTCCCAGCATGTTGAAGGGCATTAGAGGATTGGTCTTTACTGCTTAGTGAACCGGCCCTCTTCGTGGCCCTAGAGGCTGGCTTGGCTTCCGGATCTCGATCTCTGGAGCGCTCAAGCCTCCGCATCTCGGGTGAGATCAAATCGGGGATGCTCTCATAATGAATGTCAACCAGTCAGCTCCACCTGTTCCACCATATGGGCAGAACCAGCCCATCTACCCAGGGTATCATCAGTCGAGTTATGGTGGGCAACCAGGACCTGCAGCCCCTGCTACTCCCTATGGAGCCTACAATGGCCCAGTGCCAGGTTATCAGCAGGCACCTCCTCAAGGTGTGCCAAGAGCCCCACCTTCCTCAGGGGCACCTCCAGCCTCTGCAGCACAGGTCCCTTGTGGTCAGACTACATATGGCCAGTTTGGCCAAGGTGATATACAGAATGGGCCGAGTTCCACAGCTCAGATGCAAAGGGTCCCTGGTTCTCAGCAGTTTGGTCCTCCATTGGCCCCTGTGGTCAGCCAGCCAGCTGTGCTTCAGCCCTATGGCCCTCCCCCCACAAGTACACAGGTGACTGCACAGCTGGCCGGAATGCAGATCAGTGGTGCTGTGGCCCAGGCCCCTCCCCCTTCTGGGTTGGGCTATGGTCCACCAACATCATTGGCCTCAGCCTCAGGAAATTTCCCTAATTCTGGTCCATACGGCTCCTATCCTCAGAGCCAGGCTCCTCCCCTTAGCCAGGCTCAAGGTCATCCTGGAGTCCAGCCTCCCCTTCGATCTGCCCCACCTCTGGCTTCCAGCTTCACGTCCCCAGCTTCAGGTGGTCCTCAGATGCCTTCCATGACTGGACTACTCCCGCCTGGACAGGGCTTTGGGAGTCTTCCAGTGAACCAGGCTAACCACGTGTCCTCACCTCCTGCTCCTGCTCTGCCCCCGGGCACCCAGATGACTGGGCCCCCAGTACCACCGCCACCACCTATGCACTCCCCTCAGCAGCCTGGTTATCAGCTGCAGCAAAATGGTTCCTTTGGACCAGCTCGAGGCCCTCAACCTAATTATGAGAGCCCATACCCTGGAGCACCTACCTTTGGCAGTCAGCCTGGGCCTCCCCAGCCATTGCCTCCTAAGCGTCTGGACCCTGATGCCATCCCCAGCCCTATTCAGGTTATTGAAGATGATAGAAACAACCGGGGTTCAGAGCCATTTGTTACTGGTGTACGGGGACAGGTGCCACCTTTAGTCACCACCAATTTCCTGGTGAAAGACCAAGGGAATGCAAGTCCCCGCTACATTCGATGCACATCCTATAATATCCCTTGTACTTCTGACATGGCTAAACAGGCTCAGGTGCCTCTGGCCGCTGTCATTAAACCACTGGCAAGGCTGCCTCCAGAGGAGGCTTCACCGTATGTTGTGGATCATGGAGAATCTGGCCCCCTGCGCTGTAATCGCTGCAAAGCATACATGTGCCCTCTCATGACATTCATCGAGGGAGGGAGGCGCTTCCAGTGCTCCTTCTGCAGTTGTGTCAATGATGTTCCCCCCCAGTATTTTCAACATCTGGATCATACCGGCAAACGTGTGGATGCTTATGACCGTCCTGAGCTGTCTCTGGGATCTTATGAATTCTTGGCTACTGTAGATTACTGTAAGAACAATAAATTCCCTAGTCCTCCTGCCTTCATCTTTATGATTGATGTCTCCTACAATGCCATCAGAACTGGTCTTGTTCGGCTCCTCTGTGAGGAGCTCAAGTCACTCTTAGACTACCTACCTAGGGAGGGTGGAGCAGAAGAGTCAGCAATCCGAGTTGGCTTTGTCACCTATAATAAAGTGCTCCACTTCTACAATGTGAAAAGCTCCTTGGCTCAGCCACAGATGATGGTTGTATCTGATGTAGCTGACATGTTTGTGCCACTGCTGGATGGCTTCCTAGTCAATGTCAGTGAGTCTCGGGCTGTTATCACCAGCTTATTGGATCAGATTCCAGAAATGTTTGCAGATACAAGAGAGACAGAGACAGTGTTTGCTCCAGTTATCCAGGCCGGGATGGAAGCTCTGAAGGCTGCTGAGTGTGCAGGAAAGCTGTTTCTGTTCCACACATCCTTGCCCATTGCAGAGGCCCCAGGGAAGCTGAAGAATAGAGATGATAGGAAGTTGATCAACACAGACAAGGAGAAGACTCTGTTTCAGCCTCAGACAGGTACCTATCAGACTCTGGCCAAAGAGTGTGTGGCCCAAGGCTGCTGTGTGGACCTCTTCCTCTTCCCTAACCAATATGTCGATGTGGCCACACTCTCTGTTGTTCCCCAGCTCACTGGAGGCTCTGTCTACAAATATGCCTGCTTCCAGGTGGAAAATGACCAGGAACGGTTCTTGAGTGACCTGCGTCGGGATGTACAGAAGGTGGTTGGCTTTGATGCTGTTATGCGGGTTCGGACAAGTACTGGTATCCGTGCTGTAGATTTCTTTGGCGCTTTCTATATGAGCAATACAACAGATGTGGAGTTGGCTGGATTGGATGGAGACAAGACAGTGACTGTGGAATTCAAGCATGATGACCGGCTCAATGAAGAGAATGGAGCCCTACTGCAGTGTGCCCTGCTTTATACCAGCTGTGCAGGGCAGCGTCGGCTCCGCATCCACAACTTGGCCCTAAACTGCTGCACCCAGCTGGCTGATCTGTATCGAAACTGTGAGACTGACACGCTCATCAACTACATGGCCAAGTTTGCATACCGGGCTGTTCTGAATAGTCCTGTGAAGACTGTCCGTGACACTCTCATCACCCAGTGTGCCCAGATCCTGGCCTGTTATAGAAAGAACTGTGCCAGCCCTTCTTCTGCAGGACAGTTGATTCTTCCTGAGTGCATGAAGCTCCTCCCAGTTTACCTGAACTGTGTGTTGAAGAGTGATGTTCTGCAGCCTGGAGCTGAGGTCACTACTGATGATCGTGCCTATGTTCGGCAGCTGGTTTCCTCCATGGATGTGGCTGAGACCAATGTCTTCTTCTACCCTCGGCTCCTACCACTGACAAAGTCTCCCCTTGATAGTACCGCTGAACCACCAGCAGTTCGAGCCTCTGAAGAGCGCCTAAGCAGTGGCGATATATATTTGCTGGAAAATGGGCTCAACCTCTTTGTCTGGGTGGGAGCAAGCGTCCAACAAGGTGTTGTCCAGAGCCTTTTCAACGTGTCCTCCTTCAGTCAGATCACCAGCGGCTTGAGTGTTCTGCCAGTTCTGGATAATCCACTGTCTAAGAAAGTTCGAGGTCTCATCGATAGCTTACGGGCACAGAGAATGCGGTACATGAAGCTTATCGTGGTCAAGCAGGAAGACAAGCTGGAGATGCTGTTCAAGCACTTCCTGGTGGAAGACAAGAGCCTAAGTGGAGGTGCATCCTATGTGGACTTTCTCTGTCATATGCACAAGGAGATCCGGCAGCTACTGAGCTAAAGCAAGTGGGTAAATGGCATAGGGTCCCAGGCCAGCTTCCAGGAAGAACCCCAGGATGACAGAGAAATTGGGACAGTTCCATATCGTATAAGTCATGTAAGCTGACCTCAGTTGACTTCTTTTGGGGGGAGGGCGAGATATAAGGAGACACCGTCTTTCTGGGCTCAAATACACTACCACTCTGTCATGTCCTGCTGATCGAAGGTGCCTCAGGCCCCTTACTCTACCCTTTCTCCTGCTAATCCTCTTGTAATGAATGTAGTTTCTCAGTTCACTGTATATGATTCGGTGTTGGGGGTTTGGAGGCAGCTGGGCCCTGGCAACAGTGTGTCCCTTTGGATGAGCCTCCAAGAGGAAGGGCAGGCAGGAAGAAGTGGGAATCCCAGGGTTATTACAGGAGGTGGCAAATTCAGCTCCGTGTCATCAACAACTTCCTATATTAGGGACAAAATATACAGGTGCACAAGAGCTGGGGTACAGGCCGTAGGTGGTGGAGAGTAAAATAGTTGGTCCTTTGGGTGCCTGATGGTCAGTAGCAAAGTCATAGTTACCGAGGATGGATGACTAATCTCTCTACTTCCACTGCGCGTGCTCTCTCTCCCCTGCAATGATTGGTGAGCACTTCGTGGATGAATGAGCCTGGGGTAAGAATTGCAAAACATATTAACACCTTGGGGAAGTAGCAGCCTCCTTTCCAGATGGAGAAGCCCCAATCCTGGATGGTTCTGTAGAGCGCCTGATGGTCAACTTGCAATACCTCACAGAGCCAGCCCACATCCCACTCAGCTTCCACCAGAAACGTTGTTGGGGAGAGGCAGATATGGCTGGAGCCCTGTCTTCCGGTGCCAGGACGTTACTGGGCTTTGGTATTGACTGAGTGGCTGACAAGTTATCTTCCAACTCCAGTTGGCTGGGCAGGACAAGGGCTAGGAATGACCGTGGTCAGGCCTGCCTGCTCCCAGCCCAGGATGCCCCTGCTATGGACCTTTCATTTCTTTTCATTGGTTTATTTTTCAATGCATCTTTAATTTGTAAAGAAATAAAATAAGATGTAAC