Transcript asmbl_15247

Sequence
Transcript Sequence for observation asmbl_15247 of TGE0032032:
GGAAGTTGAGCCTGGGAGCCTTGACGTTAGGAACGAAGTCGAACCTGGATCTGGAGCCGGGTGAGATCAAATCGGGGATGCTCTCATAATGAATGTCAACCAGTCAGCTCCACCTGTTCCACCATATGGGCAGAACCAGCCCATCTACCCAGGGTATCATCAGTCGAGTTATGGTGGGCAACCAGGACCTGCAGCCCCTGCTACTCCCTATGGAGCCTACAATGGCCCAGTGCCAGGTTATCAGCAGGCACCTCCTCAAGGTGTGCCAAGAGCCCCACCTTCCTCAGGGGCACCTCCAGCCTCTGCAGCACAGGTCCCTTGTGGTCAGACTACATATGGCCAGTTTGGCCAAGGTGATATACAGAATGGGCCGAGTTCCACAGCTCAGATGCAAAGGGTCCCTGGTTCTCAGCAGTTTGGTCCTCCATTGGCCCCTGTGGTCAGCCAGCCAGCTGTGCTTCAGCCCTATGGCCCTCCCCCCACAAGTACACAGGTGACTGCACAGCTGGCCGGAATGCAGATCAGTGGTGCTGTGGCCCAGGCCCCTCCCCCTTCTGGGTTGGGCTATGGTCCACCAACATCATTGGCCTCAGCCTCAGGAAATTTCCCTAATTCTGGTCCATACGGCTCCTATCCTCAGAGCCAGGCTCCTCCCCTTAGCCAGGCTCAAGGTCATCCTGGAGTCCAGCCTCCCCTTCGATCTGCCCCACCTCTGGCTTCCAGCTTCACGTCCCCAGCTTCAGGTGGTCCTCAGATGCCTTCCATGACTGGACTACTCCCGCCTGGACAGGGCTTTGGGAGTCTTCCAGTGAACCAGGCTAACCACGTGTCCTCACCTCCTGCTCCTGCTCTGCCCCCGGGCACCCAGATGACTGGGCCCCCAGTACCACCGCCACCACCTATGCACTCCCCTCAGCAGCCTGGTTATCAGCTGCAGCAAAATGGTTCCTTTGGACCAGCTCGAGGCCCTCAACCTAATTATGAGAGCCCATACCCTGGAGCACCTACCTTTGGCAGTCAGCCTGGGCCTCCCCAGCCATTGCCTCCTAAGCGTCTGGACCCTGATGCCATCCCCAGCCCTATTCAGGTTATTGAAGATGATAGAAACAACCGGGGTTCAGAGCCATTTGTTACTGGTGTACGGGGACAGGTGCCACCTTTAGTCACCACCAATTTCCTGGTGAAAGACCAAGGGAATGCAAGTCCCCGCTACATTCGATGCACATCCTATAATATCCCTTGTACTTCTGACATGGCTAAACAGGCTCAGGTGCCTCTGGCCGCTGTCATTAAACCACTGGCAAGGCTGCCTCCAGAGGAGGCTTCACCGTATGTTGTGGATCATGGAGAATCTGGCCCCCTGCGCTGTAATCGCTGCAAAGCATACATGTGCCCTCTCATGACATTCATCGAGGGAGGGAGGCGCTTCCAGTGCTCCTTCTGCAGTTGTGTCAATGATGTTCCCCCCCAGTATTTTCAACATCTGGATCATACCGGCAAACGTGTGGATGCTTATGACCGTCCTGAGCTGTCTCTGGGATCTTATGAATTCTTGGCTACTGTAGATTACTGTAAGAACAATAAATTCCCTAGTCCTCCTGCCTTCATCTTTATGATTGATGTCTCCTACAATGCCATCAGAACTGGTCTTGTTCGGCTCCTCTGTGAGGAGCTCAAGTCACTCTTAGACTACCTACCTAGGGAGGGTGGAGCAGAAGAGTCAGCAATCCGAGTTGGCTTTGTCACCTATAATAAAGTGCTCCACTTCTACAATGTGAAAAGCTCCTTGGCTCAGCCACAGATGATGGTTGTATCTGATGTAGCTGACATGTTTGTGCCACTGCTGGATGGCTTCCTAGTCAATGTCAGTGAGTCTCGGGCTGTTATCACCAGCTTATTGGATCAGATTCCAGAAATGTTTGCAGATACAAGAGAGACAGAGACAGTGTTTGCTCCAGTTATCCAGGCCGGGATGGAAGCTCTGAAGGCTGCTGAGTGTGCAGGAAAGCTGTTTCTGTTCCACACATCCTTGCCCATTGCAGAGGCCCCAGGGAAGCTGAAGAATAGAGATGATAGGAAGTTGATCAACACAGACAAGGAGAAGACTCTGTTTCAGCCTCAGACAGGTACCTATCAGACTCTGGCCAAAGAGTGTGTGGCCCAAGGCTGCTGTGTGGACCTCTTCCTCTTCCCTAACCAATATGTCGATGTGGCCACACTCTCTGTTGTTCCCCAGCTCACTGGAGGCTCTGTCTACAAATATGCCTGCTTCCAGGTGGAAAATGACCAGGAACGGTTCTTGAGTGACCTGCGTCGGGATGTACAGAAGGTGGTTGGCTTTGATGCTGTTATGCGGGTTCGGACAAGTACTGGTATCCGTGCTGTAGATTTCTTTGGCGCTTTCTATATGAGCAATACAACAGATGTGGAGTTGGCTGGATTGGATGGAGACAAGACAGTGACTGTGGAATTCAAGCATGATGACCGGCTCAATGAAGAGAATGGAGCCCTACTGCAGTGTGCCCTGCTTTATACCAGCTGTGCAGGGCAGCGTCGGCTCCGCATCCACAACTTGGCCCTAAACTGCTGCACCCAGCTGGCTGATCTGTATCGAAACTGTGAGACTGACACGCTCATCAACTACATGGCCAAGTTTGCATACCGGGCTGTTCTGAATAGTCCTGTGAAGACTGTCCGTGACACTCTCATCACCCAGTGTGCCCAGATCCTGGCCTGTTATAGAAAGAACTGTGCCAGCCCTTCTTCTGCAGGACAGTTGATTCTTCCTGAGTGCATGAAGCTCCTCCCAGTTTACCTGAACTGTGTGTTGAAGAGTGATGTTCTGCAGCCTGGAGCTGAGGTCACTACTGATGATCGTGCCTATGTTCGGCAGCTGGTTTCCTCCATGGATGTGGCTGAGACCAATGTCTTCTTCTACCCTCGGCTCCTACCACTGACAAAGTCTCCCCTTGATAGTACCGCTGAACCACCAGCAGTTCGAGCCTCTGAAGAGCGCCTAAGCAGTGGCGATATATATTTGCTGGAAAATGGGCTCAACCTCTTTGTCTGGGTGGGAGCAAGCGTCCAACAAGGTGTTGTCCAGAGCCTTTTCAACGTGTCCTCCTTCAGTCAGATCACCAGCGGCTTGAGTGTTCTGCCAGTTCTGGATAATCCACTGTCTAAGAAAGTTCGAGGTCTCATCGATAGCTTACGGGCACAGAGAATGCGGTACATGAAGCTTATCGTGGTCAAGCAGGAAGACAAGCTGGAGATGCTGTTCAAGCACTTCCTGGTGGAAGACAAGAGCCTAAGTGGAGGTGCATCCTATGTGGACTTTCTCTGTCATATGCACAAGGAGATCCGGCAGCTACTGAGCTAAAGCAAGTGGGTAAATGGCATAGGGTCCCAGGCCAGCTTCCAGGAAGAACCCCAGGATGACAGAGAAATTGGGACAGTTCCATATCGTATAAGTCATGTAAGCTGACCTCAGTTGACTTCTTTTGGGGGGAGGGCGAGATATAAGGAGACACCGTCTTTCTGGGCTCAAATACACTACCACTCTGTCATGTCCTGCTGATCGAAGGTGCCTCAGGCCCCTTACTCTACCCTTTCTCCTGCTAATCCTCTTGTAATGAATGTAGTTTCTCAGTTCACTGTATATGATTCGGTGTTGGGGGTTTGGAGGCAGCTGGGCCCTGGCAACAGTGTGTCCCTTTGGATGAGCCTCCAAGAGGAAGGGCAGGCAGGAAGAAGTGGGAATCCCAGGGTTATTACAGGAGGTGGCAAATTCAGCTCCGTGTCATCAACAACTTCCTATATTAGGGACAAAATATACAGGTGCACAAGAGCTGGGGTACAGGCCGTAGGTGGTGGAGAGTAAAATAGTTGGTCCTTTGGGTGCCTGATGGTCAGTAGCAAAGTCATAGTTACCGAGGATGGATGACTAATCTCTCTACTTCCACTGCGCGTGCTCTCTCTCCCCTGCAATGATTGGTGAGCACTTCGTGGATGAATGAGCCTGGGGTAAGAATTGCAAAACATATTAACACCTTGGGGAAGTAGCAGCCTCCTTTCCAGATGGAGAAGCCCCAATCCTGGATGGTTCTGTAGAGCGCCTGATGGTCAACTTGCAATACCTCACAGAGCCAGCCCACATCCCACTCAGCTTCCACCAGAAACGTTGTTGGGGAGAGGCAGATATGGCTGGAGCCCTGTCTTCCGGTGCCAGGACGTTACTGGGCTTTGGTATTGACTGAGTGGCTGACAAGTTATCTTCCAACTCCAGTTGGCTGGGCAGGACAAGGGCTAGGAATGACCGTGGTCAGGCCTGCCTGCTCCCAGCCCAGGATGCCCCTGCTATGGACCTTTCATTTCTTTTCATTGGTTTATTTTTCAATGCATCTTTAATTTGTAAAGAAATAAAATAAGATGTAAC