Transcript asmbl_13714

Sequence
Transcript Sequence for observation asmbl_13714 of TGE0042188:
GGAAGCTTCCCCACCGCGGAGCAGCTAGACGTGCGGGCCGTCTCAGCTGTCCACTGGGAGTCGCCAACACCCTCGCTCGGGTCCCAGGGCCGCAATCACTCCTGGAGACCTCCAGCGCTTCTTTCAGAGCCACACGCAGGGCAAGTGGTGCCACCGCGCGCTAACCTGGCGCGGCCGTGACGTCAGGCTTGTGCTAGATTGGCAATTGGCTGGAGGCATGTGGCGCGGACGGACACTGGCGCGAGCGATTGGATATGCTGTTAGAGGGCGGGGCCTGGAGGCGGAGCATGCTGCGGAGAGGATTGAAGTACAGCTCTCCGCACAGCTTCTCAGCACCTGCAGCCGGAATCTCTGTGTTCTAGGTCAGATCAGACATTCTGTCACAATGCCTGAAATAAATACCAGCCATCTTGATGAAAAACAGGTTCAGCTTCTAGCGGAGATGTGTATTCTTATTGATGAAAATGACAATAAAATTGGGGCTGACACCAAGAAAAACTGTCACCTTAATGAAAACATCGACAAAGGATTATTACATCGAGCTTTTAGTGTCTTCTTGTTTAATACTGAAAATAAGCTCCTGTTACAGCAGAGATCAGATGCTAAAATTACCTTTCCAGGTTGTTTCACCAATAGTTGCTGTAGTCATCCATTAAGTAACCCAGGCGAGCTGGAAGAGAACAACGCCATTGGTGTGAAGCGAGCAGCAAAGCGGCGCTTGAAAGCCGAGTTGGGAAT