Transcript asmbl_13600

Sequence
Transcript Sequence for observation asmbl_13600 of TGE0036026:
CCCGGAACAACATGGCTACAGTGTTTCGGCCCCTGGAACGCCTGCGGGTGCCGCGTCCTTCGCTGCATCCCGGGGTGACGGGCTCAGGCTCCGCCTGCTGCCGCTGCACTCTCGGAGCTAAAAGATACCTACTCACAGATAACATTGTGAAGTTAAAGGAATTTCAACATAAGAAGATAGCTATTGCATATAACCTACCTGGCACCAAAGAAATCTATTTCAGAAACTTGGAAGAGAAGTTGACCCAGAACAAACTCATCTTGAAGGAAGAGTTGAAAACGCTGCTGTACCTGTGCCAGTCCCTGGAAGATGTGCAGCTGGCGAAAGCCGTCATTTATAGGTACCATGCAGAAAACAAGAATTTCACTTTGGGGGAATACAAGTTCGGACCAGTTTTCATGAGGCTGTGCTACGAGCTGGACCTGGAGGACTCTGCAGTGGAGCTCGTCAGAGACAAGCATCTACAAGGCTTCTTCCTAGATTCAACGTCATTCAATATTTTGATGGATATGTTATTTACCAAAGGCAAATATGAACGTGCACTTCAAGTGTTGATCGAAATGAAAAACCAAGATGTGAGGTTCAGCAAAGAAACCTACATCCTCGCTTTTGCAATCTGCTACAAACTGAATACCCTGGAATCGCTTAAAATCTGTACTACGTTAAGAGAAGAAGCCCTAATTAAGGGAGACATTATCTGCAGGAGAGCATACTGTTTTGTAGTGGCATTAGCTCTGAATAAGAACCAGTTGAAAAACGCTGTGTCCATTTTTTCTCAAATCGTGAATCCAGAAAGCATAGTGTGTATTAACTTAAATATCTTGATCCACATCCAGTCAAATATGTTGGAAAGCCTGTTAAAGATCTTAGAGGACTCTCTTGACACAAATTTATCGAAATTTGTAAGAAGACACACATTCTCAGAGGAAGTGCTGGCCAAAGTGAGGGAAAAACTGAAGGACAGCCCTGCACTCATAGCCAGATTCGATGAGGTCTATGGGAAGCTGCACGTGAACGGTCAAATCACCGTTCATTCTTTGGATGCTCTGCTCTGCCACGTCCCCCGGGACAAGAGATCCAACTTGTTGCTGTTAAAGAAGAGGGCAGTCAGCCACCGGACCTTACAGCCTCTCAGCCGGTCCCTGCTGACCGAGTAACTGCTTTCCATTTCCCTGGTCTGGAGCAGCTGCTGCTACAGTGGATTACTGGCTGCTCCGGGCCGGGCATCTTACTTACTTCAGTGGCCCTGTGCTGACGCTTGGTCTCCCTAAGTCCTAAGTCCCCCGAGTGGTGACATGCTACCAGAGAAATGGGAAGAGCTAGCTCGAGCCAAGGGAGCCCCACAGAAAGGCAGCTGCCCTCGTTTCACAGGCTCCAGAGTAAGACTCAGAGCTGCTAATGCAGCCCAGTAGAGTGGAGCTCAGGAGGTACCCACAGACGGGATTTCTCTTGGTCTTGACTGACCTTTCACGGCAGAGGTGACTCGCAAGTTGGTGGGGAGACCTGAAACCCTCATCTCCCATCTTTGGAAGTGGCGGAGGCCTTCCTCGTCTCCGCCATCGTTATTCCATCTGTGAGGCGATGCTGCCTGGGTGTGCTTGGATGACTTCACATTTCCATTCAAGGTTCAGTAGAGTTCAGCTTTCTCCAGAATAAGAAATAAAAGGTTCCTGTGCAGA