Transcript asmbl_13315

Sequence
Transcript Sequence for observation asmbl_13315 of TGE0031913:
TCCGCCCCTTCCCGGTCTTGCCCTGCAGTTTCTGCTGGGCCTAAGCCTCCGGGCTCAGTTTGACCACAGTATCTAGCTATGGCGGCAGTGACCTGGAGTCGGGCTCGATGCTGGTGTCCGAGATGCATGCTGTTCTGATCAACATGAGTTGGAGCCAATCAGTAATCCTGTTGCTGCAGAAATAAAAGGGCAAGGAACAAACAGAAACCACTATTTGTAGTGTCCTGCAGGTCTTCAGATTACAAGTGGCTAAACTGCACTTGGGCAGACCAACAATGAGAGCCAGTCAGCAGGACTTTGAAAATGCATTGAACCAGGTGAAACTCTTGAAGAAGGACCCGGGAAACGAAGTGAAGCTAAGACTCTATGCACTGTACAAGCAGGCCACAGAAGGACCCTGTAATATGCCTAAGCCTGGTATGCTTGACTTTGTCAACAAAGCCAAGTGGGATGCATGGAATGCCCTGGGCAGCCTACCCAAGGAAACTGCCAGGCAGAACTATGTGGATCTCGTATCCAGTTTGAGTTCCTCATCTGAAGCCCCGAGCCAGGGAAAGCGTGGAGCTGATGAGAAAGCCCGGGAGTCCAAAGACATCCTGGTAACTTCTGAAGATGGTATCACGAAGATCACGTTCAATCGGCCCACCAAAAAGAATGCCATATCCTTCCAGATGTATCGGGATATTATACTCGCACTTAAAAATGCCAGCACTGATAACACTGTCATGGCTGTTTTCACAGGAACTGGTGACTACTACTGCAGTGGGAATGACCTGACTAACTTCACTAGTGCCACTGGGGGGATAGAGGAGGCAGCTAGCAACGGTGCTGTGTTACTGAGGGACTTTGTAAACAGTTTTATAGACTTTCCCAAGCCTCTGGTTGCGGTAGTAAATGGCCCAGCTGTGGGAATCTCTGTCACCCTTCTGGGACTATTTGATGCTGTCTTTGCATCAGACAGGGCAACGTTTCATACTCCATTCAGCCAACTCGGCCAGAGCCCGGAAGCATGCTCCTCTTACACGTTTCCGAAGATGATGGGCTCAGCAAAGGCAGCTGAGATGCTTCTCTTTGGGAAGAAGCTGACAGCAAGAGAGGCCTGGGCTCAAGGCCTTGTCACTGAAGTTTTCCCTGAGAGCACTTTTGAGACAGAAGTCTGGACCAGGCTGAAAACATATGCGAAGCTCCCGCCAAACGCCATGAGAATTTCCAAAGAGTTAATCAGAAAAAATGAGAAAGAAAAGCTCTACGCAGTCAACGCTGAAGAGTGCACTACTCTGCAAGCAAGGTGGCTGTCAGAGGAGTGCATGAACGCAATCATGAGCTTCGTCTCCAGAAAACCAAAGCTGTGAAGACCACCACAGCAGCTAGACTCCTCATAGGGAGCATGGGCTGGGAGGTCCAGTTTCGAGGACTCAAACGACACATGCTTCTCTGTGCCTTTTCCTTGATTAACGTAGCAATTATGATGAGAATTCTTCACAGTACTGATAAATAAAACTTTTCATAA