Transcript asmbl_49168

Sequence
Transcript Sequence for observation asmbl_49168 of TGE0006025:
GCGGGGTCTCTGACTACGCTGGGGTGGGCTACCGTGGGCCTCCGGGCGGCGGTCAACGATGCTGAAGGCCAAGATCCTCTTCGTGGGGCCCTGCGAGAGTGGAAAAACCGTTTTGGCCAACTTCCTGACAGAATCTTCTGACATCACCGAATACAACCCAACCCAAGGAGTGAGGATCCTGGAGTTTGAGAACCCACATGTTACCAGCAACAACAAAGGCACCGGGTGTGAATTTGAACTATGGGATTGTGGCGGTGATCCAAAATTTGAGTCTTGCTGGCCAGCCTTGATGAAGGACTCTCACGGAGTGGTGATCATCTTCAATGCTGACATCCCAAGCCACTTGAAGGAAATCGAGATGTGGTATTCCTGCTTTGTCCAGCAGCAGTTCCTGCAGGATACTCAGTGTCTGTTAATTGCACACCACAAACCAGGCTCTGGAAGTGGTAAAGGAAACCTATCTTTGTCGCCACCCTTGAACAAGCTGAAGCTGGTACACTCAAATCTTGAGGATGACCCTGAAGAGATCCGGATGGAATTCATAAAGTATTTAAAAAGCATAATCAACTCAGTGTCTGAGAGCAGAGACCGGGAGGAGATGTCCATTATTACCTAACCAGCCTTCATCTGGACTCTTCTGCATCCCAAGTGAGGTCAACTTCTTTCCCAGTGCAGATCTGAAATCTTACCCAGTTACTGATGTTTTCTTCTCCCAATGGCCCTTGAAAAAATTTTCCTTCCCTGCTTGCAGGTACCAGTTGCCCAGGGAGTTGAATCATACAATCTAAGCCCTGTCCTTAGTTCAGGTGAGAAAATCCTGTTACTGAATTTTGATTTCTTTGCCCCAGGTTGCTTCAAAGAGCTGGAAAACTGAGGTGTTTTGTTTTCCCCTTCACATATGTCAAGTTATAAAACTTGTGGAATTGTAACTGTCATAGCCTAATCCATGCGTATTGGTTTGAATGTGATTTTCATTTCTTAATTCACTCAACAAATAGCGACTTGTTGAGCATCTACTATTGGCTACACTGTTCTAGTTGCAGACAGTATACAGCATGAACAAAATAAAAACCCTTGCTCTCATGGAACTTCTATTATAAAAAAATAGTGAGGTAGTCAAAAACTGAATTACTATACCTTGGATATGCAAAAAAAAAATATTATGGATTCTTCTTTTCTGTAATTGGTCTAACTCTAATGCACCTACCCTCCTAGATAATTAACAGACTTGGAGTATGTAACATGCAAAGGAAGGTACAGTCAGTCCTCATTCATGGATTTTGTATTTGCGAATTTGCCTACTTGCTAAAATTTATTTGTAACCCCCAAATCAATACTCACAATGCTTTGACAGTTATTCAGAGTGGCAAAAAATTTGAATCACTGGATACGCACATTCCCAACTGAGGCCGAAACAAGAAGGCAGCGCTCTGCCTTCTTGTTTCAGCTGTTGTATTGTAAACCAGTGTCCTTGTTGTGGTATATTTAGTACCACTTTTTCATATTTTTGTGCTTCTCATTGGTTATTATTTTGTTGGTTATTAAAATGCCCCTCCCCCCAAACGTAGTGCTGAAGTGCTGTCTGGTGGTTCCTAAGCACAAAAAGGCTGTGATGTGCCTTATGATGAAAATAGATATGTTAGATAAGCCTCATTCCAGCATGAATTATAGTGCTGTTAGTTGTGAGTGCAGTGTTAATCAACAACATATATTAAATAAAGTATCTTTAAACAGAAGCATACAGAAAATAAAGTTATGTATTAATAGTTGAAAATATTGTGATCAGAGGCACGCAGGAACCTAACCCTGTATTTCCCTGGGAGAAATGCTTTGGTGTTCATTAATCCATTGTTTGTGGTAACATTACAGAACATAATGACCATGAATAATGAGAATCCACTGTATTTCCATCTCTTGCAATTTAAATGTTTTCAGGTTAGTTCAGCCTCTAATAAATATTTAATTAATTCAAAATTACAATCCACTTCCTCTACATTCTCCCCAACATGATATCATGGTGTCGGGACAGTGTTTGTGTCCCTCATTGTGGTGGGGCAGCTGTTCCAAAGGAAGGTCCTCTGGCTCCCTACTTGACCTCTGTCAAGATGTCCACTGGCCACCCTATTGGCCATCTCCCACCAAGTGTAAGACTGGTGAGTCTCATGTGCTCTCCCCATGAAACTAGTGATCCCTAGGCTGACTTGGCCCCATCCTGGCTGGGGCTGGCCCTGCACATCTCTGAGAGCCATCTGTGTCTCTCATCCATCTCAAGTTTCTTTGTAGCTGTATGGCAGGATCACTTTACCCTTTGCCACAGCTGGCCTGTCCAATTCATTCTCTATGTTCTGCTTACTGGGAGAAAAGCATGATTTGGGGAGGAATTGAGAACATGGCAGATGAATATTTTCAAAATATTATCCTCATTACAACAGTAAGCAATGCAGTTATGTTTTCATTATAAACTGACAGGAGGGTTTACCTGATCATGCAGAATATTTTTTAAATTTTAACAATACTGTTGTCCTTTTTAATTGTGAAATATAAATA