Transcript asmbl_12126

Sequence
Transcript Sequence for observation asmbl_12126 of TGE0042118:
GCACAGCATTGTGGGGCGGGCGCGGCGCCGGCGACGCCATTTTCGGCGGCGGAGGGTGGCGCGAGGCTGCGGAGCGCGGGTCAGGGTGAGGATGCTGCGGGGCGGCTGCGGAGGCGCCGCTTGCTGCTGAGGCGGCTGGGCTCTGCGCGGCCTCGGCCTGTGACAGCGCGACGAGCGCGACTCTCCCGATCGGACGGATGTATGACAACATGTCCACCATGGTGTACATAAAGGAAGAGAAGCTGGAGAAGCTCACGCAGGATGAGATCATCTCTAAGACCAAGCAAGTGATCCAGGGGCTGGAAGCCCTGAAGAATGAGCACAACTCCATCCTGCAGAGTTTGCTGGAGACGCTGAAGTGCTTGAAGAAGGATGACGAGAGCAACCTGGTGGAAGAGAAATCCAGCATGATCCGCAAGTCCCTGGAGATGCTGGAGCTTGGCCTGAGCGAGGCGCAGGTGATGATGGCGCTGTCCAATCACCTGAATGCTGTGGAGTCCGAGAAGCAAAAGCTCCGCGCTCAGGTTCGACGGCTGTGCCAGGAGAACCAGTGGCTGCGGGATGAGCTGGCCAACACGCAGCAGAAGTTGCAGAAGAGCGAGCAGTCGGTGGCGCAGCTGGAGGAGGAGAAGAAACACCTGGAGTTCATGAACCAGCTGAAGAAGTACGACGACGACATCTCCCCCTCGGAGGACAAAGACTCTGATTCTTCCAAAGAGCCGTTGGATGATCTCTTCCCAAATGACGAGGACGAACCAGGACAAGGAATCCAGCAGCAGCACAGTAGTGCTGCGGCCGCCGCCCAGCAGGGCGGCTACGAGATCCCTGCAAGGCTGCGCACGCTCCACAACTTGGTGATCCAGTATGCTTCACAGGGGCGTTACGAGGTGGCGGTGCCACTCTGCAAGCAGGCCCTGGAGGATCTGGAGAAGACTTCCGGCCACGACCACCCCGATGTGGCTACCATGCTCAACATCTTGGCCCTGGTGTACAGGGATCAGAACAAGTATAAAGATGCAGCTAACCTCCTGAACGACGCCCTGGCTATCCGCGAGAAAACCCTGGGCAGAGATCACCCCGCGGTGGCAGCGACTCTGAACAACCTAGCAGTACTGTACGGTAAGCGAGGGAAGTACAAGGAGGCGGAGCCGCTGTGTAAACGAGCCCTGGAGATCAGGGAGAAGGTTCTGGGAAAGGATCATCCTGATGTTGCCAAACAGTTAAATAACCTGGCCCTGCTGTGCCAGAACCAGGGCAAGTACGAGGAGGTGGAGTATTATTACCAGAGGGCCCTGGGCATCTACCAGACGAAGCTGGGGCCCGACGATCCCAACGTGGCCAAGACCAAGAACAACCTGGCCTCCTGTTATCTGAAACAAGGGAAGTTCAAGCAGGCAGAAACGCTGTACAAGGAGATTCTCACCCGCGCACACGAGCGGGAGTTTGGATCTGTGGACGACGAGAACAAGCCCATCTGGATGCACGCTGAAGAGAGAGAGGAGTGCAAAGGCAAGCAGAAGGACGGGTCGGCTTTTGGAGAGTATGGCGGCTGGTATAAAGCCTGCAAAGTGGACAGTCCCACCGTCACAACCACCTTGAAAAACCTTGGAGCACTTTACCGACGGCAGGGGAAGTTTGAAGCTGCAGAGACATTGGAAGAAGCCGCCATGAGGTCACGTAAGCAGGGTCTTGACAATGTTCACAAACAGAGAGTGGCTGAAGTGCTAAATGACCCTGAGAGCATGGAGAAGCGGAGGAGCCGGGAGAGTCTCAATATGGACGTGGTCAAGTACGAGAGTGGCCCTGACGGAGGGGAGGAAGTGAGTATGAGCGTAGAGTGGAATGGGATGAGAAAGATGAAGCTCGGGCT