Transcript asmbl_49097

Sequence
Transcript Sequence for observation asmbl_49097 of TGE0006011:
TTCCTCTCTCTACCTCAGCAGAAGCCGCCGGGGTCTTCTTGGAGTCTAACTGTTGTAGACGCCCACCCGCTGTGCAGTTGCGATGCCGCGTGGTAGCCGAAGCCGCACCTCCCGCATGGCCCCGCCGTCCAGCCGGGCACCTCAGATGAGAGCTGCGCCCAGACCAGCGCCAGCAGCCCAGCTGCCAGCAGCAGCTCCACCATCTGCTGTTGGCTCACCTGCTGCTGCACCCCGGCAGCCAGGTCTGATGGCCCAGATGGCAACTACTGCAGCTGGTGTAGCTGTGGGCTCTGCTGTTGGCCACACGCTAGGTCATGCCATCACTGGGGGCTTCGGTGGAAGTAACACTGAGCCCTCAAGGCCTGACATCACTTACCAGGAGCCACAGGGAACCCAGCCGGCATACCAGCAGCAGCAGCAGTTTGGCCCATGCCACTATGAGATGAAACAGTTTTTGGAGTGTGCCCAGAACCAGGGTGACCTTAAGCTTTGTGAGGGTTTCAGCGAGGTGCTGAAACAGTGCAGATTTGCAAATGGATTAGCCTAATCAAGAAGTTCAAATTGAAGACATGGAAAATCATCTCTCACGACCAAGTTAATTTAGTATAAAAATATAATGGATAGTGAAAGTATAAAGTGTAAAACCACCAGTTAAACCTCTCTATTATTAATAGCTTCCTTGCCTCAGAATTGCAGTGGAAGAGAGTGTTCATACTGTATAGTTCATTGAGATGGTATTGAGTTTGGGGTTGGGCAGATGGTTTTGTGGGCTCCTTAAACCAGGTTTTGTGATGTTATTTGTGAATCGATTAGAATAAAGTGATTTTCTTCCAAAATGATGTCTGATAAATGTAAGGTCGTAAATTAAATACTGTATATGCATGCTGAACATATGCATTTTGCAGAACACAATCATCGTGTCTTTAAGTTTATCTAGTTTATAGTCTCTGGTATTAGCATCCACCCAGAGCATCTGGTAGAACTCCCTGAGGAACT