Transcript asmbl_11160

Sequence
Transcript Sequence for observation asmbl_11160 of TGE0031751:
TTGGCGTCGGGTGGGGTTGTCTGTAGCCTCCGGGTTTCGGACCGCCGCTTTATGTGTTTCCTTGGCGGACACCTCTCAGAGGGACAACGGCCGGGCTCTTCCCGGGACCGCTGCGCATTGCCTGTAGGCATCACAGTGGGTTTCCGAGAGACGTTTGGGAATCTGCGGAACTGAAAGGCATCTAGGCGCTTCCGTCCTGGTGTCCCAAGCTAGAGGTAAGCATGGCAGAACAGGAACCCACTGCTGAGCAGCTTGCGCAGATAGCTGCAGAGAATGAGGAAGATGAGCACTCTGTGAACTACAAGCCTCCAGCCCAGAAGAGCATCCAGGAGATCCAGGAACTGGACAAGGACGATGAAAGCCTCCGAAAGTACAAGGAGGCCCTGCTGGGCCGAGTAGCTGTCTCTGCAGACCCCAACGTCCCCAATGTCATTGTGACTCGACTGACCTTGGTATGCAGCACTGCCCCAGGCCCTCTGGAACTGGACCTGACAGGTGATCTGGAGAGCTTCAAGAAACAGTCGTTTGTCTTGAAGGAAGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTGAACAGAGAGATCGTGTCCGGCATGAAGTACATCCAACACACATACAGGAAAGGGGTCAAAATTGACAAGACTGACTACATGGTCGGGAGCTATGGGCCGAGGGCCGAGGAGTATGAGTTCCTGACACCCATGGAGGAGGCTCCCAAAGGCATGCTTGCTCGGGGCAGTTACAACATCAAGTCGCGCTTCACAGATGACGACAAGACTGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAAAAGGAGTGGAAGGACTGAGCTCCAGCTGGGAGACGGGCAGGGCGACGGACAGACAGAAGGACCGACATGCCCCACCCTAACCCCCTACCTACCCCAAACCAAAGTGCTGACAGGACCTCCCTCACCCGTCATTCCTCCCTAGTCCACTCAGGCAGTCAGCTCTCCTGTCTGCCCCTCCTCCACCTCCTGCCCGCAGGCCCCTGTGGTCTCCAGTGTCACATTGCTGCTTCTGCCTGTGCAGTGGGGGAGGGGTTCCAGCCCAGGCCTCCAATCTGCTGTGTCCCTCCAGGTTCCCTCTGTCTTCCCTTCCTCAGGCCCTGGCTTCTAGAATGGAACAGAACACTGTCAGGGTTGTCCAGCCCACCTTGTCTCTGTCGCAGCATGGGGAAGGGCTGGGCTATCTGTCCTCTAGTCCCACCACTCCCTGGCCAGGTCATCCATCACTGTCAGTCACTGTCTAACCATGATGCCTTAACATGTGGAACGTGTGCTGGGGGCCGTCGCTAACTCTTAACTCCCTGTCTGCATGAGCATGTGCTCTCCCTGTCCTCGCCTCGTCTGCCATCCCCATCCCAGTGACCCACCCAAGGGAGGCCTGGGGTGCGCTGCTGTTGCTTCCTGCGAGCCTGGCCAGCTCTTCCCCTCCCCGTGGCCAGGGTTGGGGGTGGCTCCAGTAGCTAGGGGAGGGTCAATTGCCAAAACTCGATGCCTCCAGCCCCATCTAGGAGGCAGGGTAGGGTGCCTCATTCCTCTGCCTTCTCTGTCCCTTGTAGGCAGTACTCGGAGCCCCTGTCCCCACAGAGAGCCCCTGAGGGACAAAGCCAGCCGAGCCTTACTTGTCTCACCTGGGCCACGTGGCCTGAACCTCGTGCCTGGCCTGTCAGTATTTATTGCCTCCATTTGGGCCAGCTGGCCTGATGCCTCTGCCCTGGTTCTTGGTGCCACCATCCCTGGGCCGACCCTCCCTGGACCCAGCCAGGACAAATGTGGGACCAAGTTCACACAGTTGGGAGCTGTCTCCTGTGCCTCCCCTCCCTATCCCCAGTCCCTGTGTGGTGTCTGCCAGGCCCAGCCTCAACAGGCAGAGGAGCCTGTCCCTGCTTCTCTTCTGACTGGGAAATAAACACCCCTGAAGGAGTC