Transcript asmbl_10765

Sequence
Transcript Sequence for observation asmbl_10765 of TGE0035846:
GAAGGAGGCCGGTTTGTTTCGGAACTGAGGCTCAAGCACAGCCGCTCAGGATTGGTGCTAGGCTGGGCCGGGGTCTTTGGCCGGAAGCGGAAGTGGAGAAAGGATGCAGGACCATCAGCACGTGCCCATCGACATCCAGACCAGCAAGCTGCTCGACTGGCTGGTGGACAGAAGACACTGTAACCTAAAATGGCAGAGCCTGGTGCTGACCATCCGGGAAAAAATCAACACTGCCATCCAGGACATGCCAGAGAGCCAGGAGATTGCCCAGCTGCTCTCTGGATCCTACATTCATTACTTCCACTGCCTAAGAATAGTGGACCTTCTTAAAGGCACCGAGGCGTCCACCAAAAATATTTTTGGCCGGTACTCTTCACAACGGATGAAAGATTGGCAGGAGATCGTAAGCCTGTATGAGAAGGACAACACCTATTTAGTGGAACTCTGTAGCCTCCTGGTTCGGAATGTCAGCTATGAGATCCCCTCGCTGAAGAAGCAGATTGCCAAGTGCCAGCAACTGCAGCAAGAATACAGCCGCAAGGAGGAGGAGGGCCAGGCTGGGGCCGCTGAGATGCGAGAGCAATTCTACCACTCCTGCAAACAGTATGGCATCACGGGAGACAATGTCCGAAGAGAACTTCTGGCCCTGGTGAAGGACCTGCCAAGTCAGCTGGCTGAGATAGGGGCAGGGGCTCAGTCCCTGGGGGAGGCCATTGACCTGTACCAGGCCTGTGTGGAGTTTGTGTGTGACAGCCCCACAGAGCAAGTGCTGCCCATGCTGCGGTATGTGCAGAAGAAGGGAAACTCGACGGTGTATGAGTGGAGGACGGGGACAGAGCCCTCTGTGGTGGAGCGACCACAGCTGGAGGAGCCTCCTGAGCAGGTGCAAGAGGATGAGATCGACTGGGGTGACTTTGGGGTGGAAGCTGTTTCCGACTCTGGCATCGTTGCTGAGACTCCTGGAATAGACTGGGGTATCTCCCTGGAGTCAGAGGCCAAGGATGCTGGGGCTGACAAGATAGACTGGGGTGACGATGCTGCTGCTGCTTCAGAGATCACCGTGCTGGAGACAGGAACTGAGGCTCCGGAGGGTGTAGCTCGGGGCTCAGACGCTCTGACTCTTCTGGAATACCCTGAAACTCGGAATCAGTTCATTGATGAGCTCATGGAGCTTGAGATCTTCTTGTCTCAGAGAGCAGTAGAGATGAGCGAGGAGGCCGACATCCTGTCCGTGAGCCAGTTCCAGCTGGCTCCTGCCATCCTCCAGGGCCAGACCAAAGAGAAGATGCTCAGCCTGGTGTCCACGCTGCAGCAGCTGATCGGCCGGCTCACCAGTCTGCGGATGCAGCACCTGTTTATGATTCTGGCCTCGCCAAGGTATGTGGACCGAGTGACAGAGTTCCTCCAGCAGAAGCTGAAGCAGTCGCAGCTGTTGGCTTTGAAGAAGGAGCTGATGGTGGAGAAGCAGCAGGAGGCGCTTCAGGAGCAGGCAGCTCTGGAGCCCAAGCTGGACCTGCTGCTGGAGAAGACCAGAGAGCTGCAGAAACTGATTGAAGCCGACATCTCCAAGAGATACAGTGGCCGTCCTGTGAACCTGATGGGGACCTCTCTGTGACGCGCTCCCTCTGTGTCCTCCACCCTCCTTCCCAGCTACCAGGAGGAGGTGGGACAGCCCAGGCTGATGCTACTGGGCCTCACCAGCAAGAAGTCAGGCGGACTTGGAGACAGAGCCATGAGGAAGGGTCACACCATGATCTCTGCAAGCAGTTGTCTTGAGTGGCTCTGGCCTGTCAGCCTTAAGGCACACTTGCTGCTTCTAGTTGTCAAGTGAGGCTTAATAAAAGGAAGTGACTCTCCTTCGTGGCTGGCAGTCAC