Transcript asmbl_48522

Sequence
Transcript Sequence for observation asmbl_48522 of TGE0005978:
GTTTAGTGAGTAGTTTTGCAAGACTTGTTTCACTTTGTTTTGGACAAGGCTGAGACTCATATTTCAAACAAAAGGCAGCCAATTACTAACATCTGGTTGCTGGGTGTGGTCTCCTTTCAAATTCTATAAAATCTGAAGCCCAAGGCTTCACTTCCAGTGTGAAACAGTCGGAGAAGAATCTCTCTTTAGCTTCTGAAAAGAAGGTGGAAAAAAAGAAACTTCTTCAAAAATGTCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATACGTTAAAACTGTGAAAGCATCCAAAGGTGGTCCTGGGTCAGCAGTGAGCCCCTATCCTAGCTTCAATCCATCCTCAGATGTCGATGCCTTGCATAAAGCAATCATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGAGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAAAAGGAAAGCCCCTGGATGAAGTTCTGAAGAAAGCCCTGACAGGTCACCTTGAAGAAGTTGCTTTGGCTCTATTAAAAACTCCAGCCCGGTTTGATGCTGATGAACTGCGTGCTGCCATGAAGGGCCTTGGAACAGATGAAGAGACTCTGGATGAAATTTTGGCATCAAGAACTAACAGAGAAATCAGAGAAATTAACAGAGTCTATAGAGAAGAATTGAAGAGAGATCTGGCTAAAGACATCACCTCAGACACATCTGGAGATTATCAGAAGGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGATATTGGCATAAATGAGGACTTGGCTGATTCAGATGCCAGGGCATTATATGAAGCAGGAGAAAGGAGAAAAGGGACAGATGTGAATGTGTTCACTACCATTCTTACCACCAGAAGCTACCCCCATCTTCGCAGAGTGTTTCAGAAGTACACCAAATACAGTCAGCATGACATGAACAAAGTTCTGGATCTGGAGATGAAAGGTGATATTGAGAAGTGCTTCACAACCATCGTGAAGTGTGCCACTAACAAACCAATGTTCTTTGCTGAGAAGCTTCATCAGGCCATGAAGGGTGCTGGAACGCGTCATAAGGCATTGATCAGAATTATGGTTTCCCGTTCTGAAATCGACATGAACGATATCAAAGCCTGCTATCAGAAGTTGTATGGTATCTCTCTCTGCCAAGCCATTCTGGATGAAACCAAAGGAGATTATGAAAAAATCCTGGTGGCTCTCTGCGGAGGACAGTAAATATTCCTTTAATGATCTCAAGCTTTTTGATCAGAAGATTTTTTAATCATATCTTTTCATTCCATATTACAGACTTAAATAGAAAAGTTTGTTCAGCAGAATTAGTTAGCTAACTGCTTTCTGAAAACTATGGCTTATAAATCATTTTTATATCATAACTCTGTATAATAGAGATAAGTTTTTTAAAAATTTATTTACCCCAATTATAAAACCCCACGAACAGGTTGTTCTAGTACCATTACTTGAGAAAGATGTTTATGTAACAGAAAATAAAATGATTTTACAGGACAATTGGTGTGTCATTGGTTCTTCTATTCTGATTTTTTTCTATGTGTAATGTAGTGGTTTAATTTGATATAAGGAGATAGGAACTTGAATTCTAAATTATAATTATTTAATGAAATAAATATTACATAGTAAATTAAAGTATTCACAGAGGTAGAAAATGG