Transcript asmbl_48488

Sequence
Transcript Sequence for observation asmbl_48488 of TGE0005972:
CCCGGTTCCTGCTCCATTCTGCGGTCCCAGAGCTTGAAGGCCTCTGCCACGGTCACCGTGACCCCGCGCCTCTGCCGCCCCCCGGCAGGTGTGATCTCCCCTGAGGACCACAGGGAAGCTCATCTCCCTGCTTGGCTTCTACCTTTAACTCTTGGGAGCATCCCCTAACACATCCAAACTACAATCCAGACCCAAGAGGGCAAAGTCCAGAAAGAGGTCAAGATGGGGTTTATATTTTCAAAAGCTATGAATGAAAACATGAAAAACCAACAGGAGTTTGCGTTAATGAATGCTCGACTTCAGCTAGAAAGGCAGCTAATAATGCAGAATGAAATGAGAGAAAGACAAATGGCCATGCAGATTGCTTGGTCTCGAGAATTCCTCAAATATTTCGGAACATTTTGTAGCCTTGCAGCAATCTCTTTAACAGCTGGAGCAATAAAAAGGAAGAAGCCAGCCTTCCTCTTTCCTCTTGTTCCATTAGGCTTTGTCTTTACCTACCAGTATGATTTAGGCTATGGAACCCTTCTACAAAGAATGAAAGGTGAAGCCGAGAACATACTGGAATCAGAAAAGAGTACATTGCAGTTGCCAAAAGGAATGATTACTTTCGAAAGCCTTGAACAAGCCAGAAAGGAACAAAGTAAATTCTTCATAGACAAATGAAATCATGTTTACCCACCAAATCTCAAAACACAGAATTGTTGACTCGAATCATGGTTTTTACAATTTCTTAAATGCTCGAGATCTTGATGTAATGGATTTTATTTTTAAATTTTAAAAATCAGTTTTGTTAAACTATTTTAAAGTAAAATTTATAACATTCAACAAAAAATGGAGGTTCTCTAAGTAACTTTCAGATTTCCTATATGTGTGTGTGTGTATAATAAATAAATGTGAAATTAATAAACTATGTTGTTTT