Transcript asmbl_8779

Sequence
Transcript Sequence for observation asmbl_8779 of TGE0041829:
CACAGTCCACAAAGGCTTTTTATTTATGCTTTACATTTAAAAAAAGAATCCCAGGATTTTCCCTCCTGTATGTTTTCGTCTTGCCTCTTCATGGTCCATAATGCCAGCCGAGGTTGTCAGCACAATGAGGCCAAACTGACGTGAAGGGAGCAGGTTGTTCTGCCATTTCTCTAGGTCTTTGAGTTGAACATCAAATCTAGGGCTTATAACGCCACACTTGTTCAACCTTCCTGTGAGGTTCACAACAATCTTCCCAGCTCTGTGACCATCAATGATCTCGAATTCACCAATGTATCCGTGCTTCATCATCACAGTTAAGAACCGAACGATGACTTTAGAACATGGCCTGATGAGGACCTGGCGTTTGCCTCTCTTCTCAGCGTTGTTGATGCTCTTGAGAGCATCCGCCAGAACATTCATTCACACCATGGTGGCGGCGAAGGAAGATGGCAGAAAG