Transcript asmbl_729

Sequence
Transcript Sequence for observation asmbl_729 of TGE0003178:
CAGCCTTCGCCGCGCCGCTGCCGCTCTCCAACGCCAGCGCCGCCTCTCGCTTGCCGAGCTCCAGCCGAAGGAGAAGGGGGGTAAGTAAGGAGGTGTCCTTACCATGGCTCGTACAAAGCAGACTGCCCGCAAATCCACCGGTGGTAAAGCACCCAGGAAACAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCCCTCCGTGAAATCAGACGCTATCAGAAGTCCACTGAACTTCTGATCCGCAAGCTCCCCTTTCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTCAAAACAGATCTGCGCTTCCAGAGTGCAGCTATTGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGATACCAATCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGATATCCAGCTAGCACGCCGCATACGCGGAGAACGTGCTTAAGAGTCCACTATGAGGGGAAACATTTCATTCTCAAAAAAATTTTTTTTCCTCTTCTTCCTGTTATCAGTAGTTCTGAATGTTAGATATTTTTTCCATGGGGTCAAAGGTACCTAAGTATATGATTGCGAGTGGAAACATAGGGGACAGAATCAGGTATTGGCGTTTCTCCACGTTCATTTGTGTGTGAATTTTTAATATAAATGCAAGATGGAAAGCATTAATGCAAGCAAAATGTTTCAGTGAACACATTTCAACAGTTCAACTTTATAACAATTATAAATAAACCTGTTAAAATTTTCTGGACAATGCCAGCATTTGGATTTTTTTAAAATAAGTAAATTTCTTATTGACGGCAACTAAATGGTGTTTGTAGCATTTTTATCACACAGTAGATTCCATCCATTCACTATACTTTTCTAACTGAGTTGTCCTACATACAAGTACATGTTTTTAATGTTGTCAGTCTTCTGTGCTGTTCCTGTAAGTTTGCTATTAAAATACATTAAACTAT