Transcript asmbl_6868

Sequence
Transcript Sequence for observation asmbl_6868 of TGE0032163:
TTTTTTTTTATATACATAAAGTATAAATCATTTATTTTCCTTCTAATCCTTAGCTCAGTACATCGATGGCTTTTCTTCACCCTTCGGGTTGACGATTTTCTCTAGGTTGCTGCTGATGATATGATAAAGCTCAGCATAGAAGGCCCTCAGGTCCAGCACCATGGCCCTAAGCGCCCCATAGGCTGCTTCATCTCGCTCATGCACCAAGGCCCGGTAATCCATTACATGGGTATCCTTGGAAGCCTTGGCTACAGCATCCCCTCGTTCTGAGAAGTACTTGGAAATAGTTGTCTGGAAAGCTTCTACTTTGGTCTTGACAGCATTCACTCTCTCCAGCACCTTCTCCTGAATTGCCACCCCAAAATCATTTCCATCCTCAATCTTGGGGATCAGGTGCTGGATCCACGTGATTACCAGAATGCACTTCTCTTTGAGAGTCCAGACTTCTGGCTTAACCAAAGCAAGCAAGGCCAGAAGCTTCTCGTTCCCCGGGAGGTAGCCACACTTAGGGACTTCCTTCTTCTCCTGCTTGTCTGTTTCCATCTCGTCATCCTTGGGTGGAGGATCTGGGATAGGGATGTCCAGAGGAGCCCGGAGGGAGGAGAGGTCGGCCACATTGAGGGAATCCTCCTGCAAGAGCTGACTCAGGGATATGATTTTCCGTGGCAAGAAAGTGCAGAGGAAGTCATCAGCCTCCTGGAAAAGATTTTGTCTGAAGACATCCACCTGTTTTCGGGCTTCTCCACTCAAGCGGACCCCACAAGGCTTGGCCATGCTTCCCCCCACTTGGCAGCTCTCGAGCCTCGTCCTGTATTTCTTTAAGTGAGTTATTAATGCCCTTCTTAAGGTCCTCTACCAGCATCATGAGATATGATTTTGAATCTGAATCTTGCTCTTCCGGTGTGTTGCGGTATCCAGGACTGGCTGAGATGGGAGTGCTGGGTTCTGAT