Transcript asmbl_60049

Sequence
Transcript Sequence for observation asmbl_60049 of TGE0003105:
CCCCGCCCGCTGCCGCGACGCCATTTGCCACTGCCGAGCGTGGGCACGGGAGGCTCTCGCAAGCACGGGTGACCAGCCTCTCCTGAGCACGCTTCCCGACCTCCCGCACGGTCTTCGTGGCGCGCACTTCTCGGCGTTGCCCGTCGGAGTCACCGCAGTTCCTGCCGCCAGCCTGAGTGCGGTCCCACACGCTGCCAGCCAGTCTTTGCGGCCATGCCCAAGAATAAAGGAAAAGGAGGCAAAAACCGGCGTAGAGGCAAAAATGAGAATGAATCTGAAAAGCGAGAGCTTGTGTTCAAGGAGGATGGGCAAGAATATGCTCAAGTAATCAAAATGTTGGGAAACGGACGATTAGAAGCCATGTGTTTTGATGGTGTAAAGAGACTGTGCCACATCAGAGGGAAATTGAGAAAAAAGGTTTGGATAAATACCTCAGATATCATATTGGTGGGGCTACGAGATTACCAGGACAACAAAGCCGATGTCATTTTAAAATACAACGCAGATGAAGCTAGAAGTCTCAAGGCCTATGGCGAGCTTCCAGAGCATGCTAAAATCAATGAAACTGATACATTTGGTCCTGGAGATGATGATGAAATTCAGTTTGATGACATTGGGGATGATGATGAAGACATCGATGATATCTAAAGCGAACTCAACATTTTACATTCCAGTCTTCCGGAAGATTGTCCTTCAAGTTTGGAATCTGGCCATAGACCTCAAAGAAAAATTTTCACTATCATCTTAATTGTAATTTGTTGAGGCAGATTTGATATTACAGTCTTTGAAAAACTGTTAACTGATACGCTAAGTCCACTTTGTTGATTCGATTCAATGGTCCTTAAGACTGTTTAAGACAAAAAGCCTTTCCTACTTTGACCCCTTCCAGTAAGTAAATGGGTGTTTTGAATAAACCATTTGCCTTGTGCTCAGTATAAAGTATGACTAAGCCCTGCCTTTGCATAGCTGTTGACTGGACAGTCTTTGTGTATATTCCAGTTGCCCAGAGATTTTGATACACATGGAGGCAGAAATCTGTGTTTTGTTTTTGTTCTATTTTGAGACAGAGTCTAACTTTGTATCTGAGGCTAGCTTGGAGTTCACTGTAGTGCTGGTGGACCTCAGACTTGCTGGGATCCTCCTGAGTGCTAAGGGCATATGTATGTACCACCATACCTGGCAGAAATCTATTTAAAGGCAAAAATGATAGGTCTGCGTTTCATATTTAAGTATGTGGCTATTTTTATACTGGTTTTGATACCATGTACATTTTTTTTCATGATTTTATTTTGCAGTCATCGGCTTACTGGAGGAGGAAAGGCATTTCCAAAATGGTTTTTTGGGTTTGGAGGTTTGTTTGTGGGCGGGGAGTGTTGAGACAGGGTTACTTTGTGTGGCCCTAGCGATAATGAAACTCACTCTGTACACCAGGCTGGCCTCAAGCTCAAAGACGTTTTCCTGCCTCTGCCTCCCAAGT