Transcript asmbl_48341

Sequence
Transcript Sequence for observation asmbl_48341 of TGE0005955:
TGGGCGCGAGGCGCGCAGGCGCCTTGGGGACCCGGTAGCGGCGGTGGCAGTGGCTGCGGCGACGGGATCCTTGGCCGAAACTGAAGGCGGTGGTGGCGGCCATGGCGGCCGATGGAGAGCGATCCCCGCTGCTCTCCGAGCCCATCGATGGTGGTGCTGGCGGCAATGGATTAGTGGGACCAGGCGGGAGTGGGGCTGGGCCCGGGGGAGGCCTGACCCCCTCCGCACCACCGTACGGAGCCGGTAAACATACCCCGCCCCAGGCATTTCCCCCATTCCCTGAGGGACATCCAGCCGTGTTGCCTGGGGAGGACCCACCCCCCTACTCACCCTTGACTAGCCCGGACAGTGGGAATGCTCCCATGATCACCTGCCGAGTCTGCCAGTCTCTCATCAACGTGGAAGGCAAGATGCATCAGCATGTAGTCAAATGTGGCGTCTGCAATGAAGCCACTCCAATCAAGAATGCACCCCCAGGGAAAAAATATGTTCGATGCCCTTGTAACTGTCTCCTTATCTGCAAAGTAACTTCCCAGCGGATTGCCTGCCCTCGACCCTACTGCAAAAGAATCATCAACCTGGGGCCTGTGCACCCAGGACCTCTGAGTCCAGAACAACAACCTGTAGGTGTCAGGGTCATCTGTGGACATTGCAAGAATACTTTTCTGTGGACGGAGTTCACAGACCGAACCTTGGCCCGTTGCCCTCACTGCAGGAAAGTGTCATCTATTGGGCGCAGATATCCACGAAAGAGGTGTATCTGCTGCTTCTTGCTTGGCTTACTCTTGGCAGTCACTGCCACTGGCCTTGCCTTTGGGACATGGAAGCATGCACAGCAATATGGAGGCATCTATGCAGCCTGGGCATTTGTGATCCTGTTGGCTGTGCTGTGTTTGGGGCGGGCCTTCTATTGGGCCTGTATGAAGGTCAGCCACCCTGTCCAGAACTTCTCCTGAGCCCCATGATCACCCACAGACTGTGCCTGGCCCCTTCCTGGTGGGGACAGTGACACTACAAAGGGAACCATAATCAAAGGCTCCCTGGGCTTCTATAAGGGAAGCCAAGCAGCTGCCTTCCTTTTCCCTGGCGAGAGGTAGGAAGGGACCAGGCCCTCACCTAGGTTTGGAGGGGTAGAAAAGGCCACTGTTGGCCTGGCCACCTGCTTTCCTCCAAGAGTTGCTATGTTTAGGGTGAGGTAGGTGAAATGTTGCCCCTAAACCTGGGTCATAAAAGATGGTTCTAGCCATGTCCTTCCTATGTGCTCCCTGAGAGCCATTCCTGTCCCTTACACATTCCAGGGCAGGGTGGGGGTGGGTAGCCCTGGGGGTTTCCCTCCCTCTTGTGTACCATTAGGACCTTGCTGCTGCTATTGCACTTCACCAGGGGCTGGCTCTGGCCTCAGTACCCTCAGTCTCCTCCCCCCATTCCATGTCCTATGGGGGTGGGGTCAGCCGCTGCTCTGTACAGAACCACAGGAACTGATATGTATATAACTATTTAATATGGGGAATGTCCCCCTAGTCCTGTGTTTCCCTTAATTCCTCCTTCCAACCTTACTCCCCAGTGTATTTAACTGGGCTGGGTAGGGTTGCTCTGTTGTGGGGGAGGTTAGGGATTCATCCTGTGCTTGTAAATAAATAAGGTCGTGAC