Transcript asmbl_48310

Sequence
Transcript Sequence for observation asmbl_48310 of TGE0005949:
AGATAGTGCACTATCTGTGCAGACAGGACGGGAGACCGCGGTGTCGTTTAGCAGAGCAGAACCGAGTTGAGAAGGTCAGGCTCATCTAGAGGGTGTCGGCGGAAACATGGAGAAACGACTCACATATGAAGATTGTCAGTACACTGCAGAATGGCTTCTGTCCCACACCAAGCACCGACCTCAAGTGGCAGTGATCTGCGGTTCTGGGTTAGGAGGTTTGACTAATAAATTAACTCAGACCCAGATCTTTGACTACAGTGAGATACCAAACTTCCCCCAAAGTACAGTGCAAGGTCATGCTGGTCGACTGGTGTTTGGGTTCCTGAATGACAGAGCCTGTGTGATGATGCAGGGCAGGTTCCACCTGTATGAAGGCTACCCGCTCTGGAAGGTGACATTCCCAGTGAGGGTTTTCCAGCTTCTGGGTGTGCACACCCTCGTGGTCACCAATGCAGCTGGAGGGCTCAACCCCAAGTTTGAGGTTGGAGACATCATGCTAATCCGCGATCACATCAACCTACCTGGTATTTGCGGTGAGAACCCTCTCATAGGGCCCAATGATGAAAGGTATGGAGTTCGTTTTCCTGCCATGTCCGATGCCTATGACCGGGAGATGAGGCAGAAGGCTCATAGTACCTGGAAACAAATGGGAGAGCAGAGAGAGCTACAGGAAGGCACCTACGTTATGGTGACGGGCCCCAGCTATGAGACTGTGGCAGAGTCTCGTCTGCTGCAGCAACTGGGTGCAGATGCTGTTGGCATGAGCACAGTACCAGAAGTTATAGTTGCAAGGCACTGTGGACTTCGAGTCTTTGGCTTCTCCCTCATCACGAACAAGGTCATCATGGATTATGAAAGCCTTGAGAAAACAAACCATGAGGAAGTACTAAAGACCGGGAAACAAGCTGCGCAGAAATTGGAGCAGTTTGTCTCCATTCTTATGACTAGCATTCCACTGCCTGACCATGCTAGTTAACCAGCCCTGGGGTGGTCTGGCTTCTCCCTTATGGTTTCCAAGTAGTTGCTACCTACTTTGCTGGGGTCACATGCCTCTGTCCTTACGCAGTAGCAGAAAAGAGAGGAAGATTTTTATATTTCCCTTTCCCACTTCTCCCACCAGATTCTTCTGGTGCTGGGTCCTCTTTTGCTCAATTGTCTTCTCAAAACAGTGTCCACCTCTATTCTTTCACAAGAGCTGGAGCTCAAGCCAAGCCCTACTACACATCCATAGATATTTGATGTTGGCTGTTGAACTTGACACAGTAGAAGTCGATGCTAGCTTTTTGAGATGATGTTCTCACATTCCTGGGGACTCAGTTCTGCCTCCCCCAAAGTACTGGAAACCACACAAGGACCAGCCCAATACCTTTTATACTTTTAATGCTTTATATTTTGAAAATAAAGAGAAAGATGAAATAATTTCTTCATTTTTGTACAGTTGGGATTAGGCTGGGGCACAGTCCAAGATTGGCCTGAAAGGCTGTGAGACCACATGTGTTATTATGACTATTTGCTTTCTAGACAGGTAGCTAAGAACTGAGATGAGGCGCTATGTGAATGCAGGGAAGGATGAAGAAAAGGCAAGATGATGAAAGATAAAGATATTAGAAGATGATAAGGGAGAAAAGGCTAACTTCTGCGATATGATGGCCACTTCCCTAAGACCAGTCTTGCCTCTGTCCCTTGCCTTCTTTTTTCACCTCCTCTCTACTCTCATAAATATCTGAAT