Transcript asmbl_48244

Sequence
Transcript Sequence for observation asmbl_48244 of TGE0005942:
CACGGTAGACTCCGACCATCAGGCTGACGTTGCCCCGGCTACGCCTCTCCCGCCCGCCACGGCGTAGCTGGCGATTGGTGGAGAAGGCGACAGCTGTCCCAGCGGAGGCGACGACGGGGCGGCCTCAAGGAGTCGCAACGAGCCAGAGCGCGTCACGCCCTGGTGCTGCGGTGGTCGCTCGCGTCTTGTCGGCCCGTTCCGTGTTGCCCTGCACTGCCGCGGCCGCCGCGGAACCATGGCTGTGCTCGTCGTGCTGTTGTCCTTGGTGGCGGGTGTTTTGGGAAACGAGTTTAGTATTTTAAGATCACCGGGGTCTGTTGTTTTCCGGGATGGAAATTGGCCTATACCAGGAGAGCGAATCCCAGATGTTGCTGCATTATCCATGGGCTTCTCTGTGAAAGAAGATCTTTCTTGGCCAGGACTTGCAGTTGGTAACCTATTCCATCGTCCTCGGGCTACCGTTATGGTGATGGTGAAGGGAGTGGACAAACTCGCTCTACCCCCAGGCAGTGCCATTTCATACCCTTTGGAGAATGCAGTTCCTTTTAGTCTCGACAGTGTTGCAAATTCCATTCACTCCTTATTTTCTGAAGAAACTCCTGTAGTTTTGCAGTTGGCTCCCAGTGAGGAAAGAGTGTATATGGTGGGAAAGGCAAACTCAGTTTTTGAAGATCTTTCAGTAACGTTACGACAGCTCCGCAATCGCCTGTTTCAAGAAAATTCCATTCTCAATGCACTTCCCCTCAATTCTCTGAGTAGGAACAATGAAGTTGATCTGCTCTTTCTTTCTGAACTGCAAGTTCTACATGATATTTCAAGTTTGTTGTCTCGACATAAGCATCTAGCCAAGGATCATTCTCCTGATTTATATTCACTGGAGCTGGCAGGTTTGGATGAAATTGGGAAACATTATGGGGAAGACTCTGAACAATTCAGAGATGCTTCTAAGATCCTTGTTGACGCTCTGCAAAAGTTTGCAGATGACATGTATAGTCTTTATGGTGGGAATGCAGTGGTAGAGCTAGTGACTGTCAGATCATTCGACACATCCCTTGTGAGGAAGACAAGGACTATCCTTGAGGCAAAACAAGAGAACCCACCAAGTCCCTTTAACCTTGCATATAAGTATAATTTTGAGTATCCAGTGGTTTTCAATATGGTACTTTGGATAATGATCGCCTTGGCCTTGGCTGTGATTATCACCTCTTACAATATTTGGAACATGGATCCTGGATATGATAGCATCATTTATAGGATGACAAACCAGAAGATTCGAATGGATTGAACTTTCCTTATGCCTAACTTAGAAAAGGGGTTTGGAAATTGTTTTCTTAAAATAAATCTTTAGTGTAGTTTAAAGTAGATAGTATACTTTAAATTTTTTAAAGAAGTAAATTTTGTTCTCAGTTTTGTGTGTGCTTGTGAAGTTGTTTTAGAGTGAATTATGGTATTGATGTGAATTGATTTGTGTGATATAAATTCCATAATATCCTCAAATATTATGATATAACCATTTAATATAATTTCATTCCATTTAATATTTGGAAATAATGCACTGAAATAAATGTAAAACATTTAGAATAGCTTGTGTTATTTATGTTAGGAAAATGCACTGAATTTGTTAGAGGCACTTATGAATGCTTAATTTCCTTACACAGGACAGATTTAAATGATATTTGGGCTATTGTGTACTATGAACTATTTGTAAATGTCCTAATTTGATGTAAATATCTCTGAAACGAGAAATGGTTTTCACTTAGCACAGCCCTCAACTATGAGTGTGTGTATACAGTCACTTTGATTTGGAACTGCATCTGATTGACAGAGGATAGCTGTTTTTTTAACCTCTTCTGAAAGTTTGGTGATCTGGATGGTCTAGTGTGGGTATTAAAAATACTACATTGATCTCAGAAGAAACTAGCTTTGTGAAGTTACAGATATTCATAATTATACACATAAAAACAAACATTTGGGGGACATCTTGGGGCATGAATATAAAAATCTTTTTATTTCAGTTAACTTTTCCCACTGTGTAAGTTACTATGGTTTGTGGTACATCATTCTATAGAATATTAAGTGAAAGTAGATGCTCCTTACTTTTCATGTGGAAGTGGACCAATGTCTATAAAGAGTCACAAATAAAGTTAATGATTCCAAA