Transcript asmbl_47923

Sequence
Transcript Sequence for observation asmbl_47923 of TGE0005904:
CGCGGAGGAGGTGGAGGAGGTGCCGGGCGGCCGCTTCCCGCCCCCGAGCGCGAGCCGGTTCCGAGCGGAGTGGAGCGGAGGTCGGACCCGGAGCGGAGCCGGCTGAGCGGGCGCTGAGCCCCCGCCATGGCCCGGAACACGCTGTCCTCGCGCTTCCGTCGGGTGGACATCGACGAGTTTGACGAGAACAAATTTGTGGACGAGCAGGAGGAGGCGGCGGCGGCGGCGGGCGAGCCAGGCCCGGACCCCAGCGAGGTGGATGGGCTCCTGCGGCAAGGGGACATGCTTCGGGCGTTTCACGCAGCCTTGAGGAACTCTCCTGTCAACACCAAGAATCAAGCCGTGAAGGAACGAGCCCAGGGCGTGGTGCTGAAAGTGCTTACAAATTTTAAGAGCAGCGAAATTGAGCAGGCTGTGCAGTCACTGGACAGAAATGGCATTGACTTGCTAATGAAGTACATTTATAAAGGGTTTGAGAAGCCCACAGAAAATAGCAGCGCAGTGTTACTCCAGTGGCATGAAAAGGCGTTAGCAGTAGGAGGACTAGGCTCCATTATAAGAGTTCTTACAGCAAGAAAGACTGTTT