Transcript asmbl_47756

Sequence
Transcript Sequence for observation asmbl_47756 of TGE0005895:
GGCGTTCCCTGCCCCAGGCCACGCCACGAGGGACGCCGAGCGGGGCCCCGGCCCGCGTGGGGGCGGCGGGACCCGGAAGGGGAGCGGCCGCAGGAGCCGGCGGGGCAGCTACGCGGGGTCCTCGCGCGCTTCCCACGTGGGCTCGGGCGGAGACGCGGTCTCGGCCCGCGCGGTCCAGACGTACTTGGCTCGCCTGCGTGTGGCCGCGGTTGCGCGTCGACCATGGCGGTTACCGACGGATTGCTTCTCCACCTTTCCGAGCCCCCAGCCGCCGCCGCCGCCTTCAGGACGTTCTCCAGACCCCGCGTGGCCCAGGCGAGGCGGCAAGCACAGGCCACCAAAAGGAAGTACCAAGCATCCAGCGAGGTTCCCTCAGCGAAGCGGAGGAGCAGGGCATCCTCTCTGCCCGCTAAGAAAACCACCGCGGAAGGAGTGCAGAGGGCTCCCGAGGGGAGGGCGCAGACGGCGTCTTCCCCGCGGAGGTCTTCGGCCGGCGGCAGGGGTAGGAACCAAGAGCAGAAGCCATGCGTTAAGACCTCCTCGTTGTTTAAAAACAACCCCGAGATTCCAGAACTCCACAGACCCGTCGTACAGAAGGTGCAAGAAAAGGTGTTCTCTTCAGGTGCTTTTCATGACCTGGACCTCCACCCTCATTTGATTTCCACAATAAACACAGTCTTAAACATGTTCAACATGACCAGTGTTCAGATGCACAGCATTCCCGTGCTGCTGGAAGGCAGAGATGCCCTCGTGAGATCGCAGACCGGCTCAGGTAAAACTCTTGCCTATTGCATCCCTGTGGTCCAGTCCCTTCAAGCAATGAAAACGAAAATACAGCGCAGTGACGGCCCCTATGCTCTGGTGCTGGTGCCCACGAGAGAGCTGGCTCTACAAAGCTTTGACATCTTCCAGAAACTTCTCAAGCCGTTCACTTGGATTGTGCCCGGAGTGCTCATGGGAGGCGAGAAGAGAAAATCGGAAAAAGCCAGACTCCGCAAGGGAATAAATATCCTTATCTCAACTCCGGGGCGACTGGTGGATCACATCAAATCCACAAAGAACATTCATTTTAGCCGGGTACAGTGGCTGATTGTGGATGAAGCCGACAGAATCTTGGATTTGGGTTTTGAGAAGGATATCACAGTGATACTCAATGCAGTCAATGCCGAGTGTCAGAAGCGACAGAACGTCTTGCTGTCGGCGACACTCACGGAAGGGGTGGCCCAGCTCGCCGATATCAGTTTACTCAACCCAGTCAGTATTTCTGTCCTGGAAGAAGGCTACGGACAGGCTAACCCACAGGGCGGAGGAGCTCTTGAAGTCTCCGCTCCACAAACCAGCGACGAGTTGGACAGCTTCGCGATACCGGAGGGTCTCGATCAGCACGTGACCTTGGTTCCCAGCAAACTGAGGCTGGTCTCCCTGGCGGCCTTCATCCTGCAGAAGTGCGCGTTCGCAGCCGACCAGAAGATGATCGTCTTTTTCCCGAGCTGCGAGCTGGTGGAGTTCCACTACACGCTCTTCGTCCAGACCCTGCTGCCCCGCCCGGGAGCCCCGGCCGCGGCGCCCTTACCATCCGGCTCCACGCAGTTGAAGTTCCTGCGGCTGCACGGGGGTCTGGAGCAGGAGGACAGAATAGCCGTGTTTCAAGAATTCTCCCATTCCAGAACGGGCGTTCTCCTTTGCACGGACGTTGCGGCTCGGGGCTTAGATCTCCCTCAAGTCACGTGGATTGTTCAGTACAACGCTCCGTCTTCGCCGGCTGAGTACGTCCACCGGGTTGGGAGAACTGCCCGCATTGGCTGCCGGGGGAGCAGCCTGCTCATTTTGGCTCCTTCGGAGGCAGAATATGTCAACTCGTTGGCTTCTCACAAAATCAATGTTTCCGAGATTAAGATGGAAGATATTTTGTCTGTTCTGACAAGGGATGATTGTTTTCCGGGGAAGCAGTGGGGAAAGCAGAAACCCCGTGCCTTGAGCCCCCAGGGGATCCGAGAGCGAGCCACGGTCTTGCAGACGGTGTTTGAAGATTACGTGCACTCCAGTGAGCAGACGGTCTCCTGGGCAAAGAAAGCCCTGCAGTCCTTCATCCGTGCCTACACCACCTACCCCCGAGAGCTGAAGCACATCTTCCACGTTCGGTTGCTGCACCTTGGGCACGTGGCTAAGAGCTTCGGGCTAAGAGATGCGCCCCAGAATCTTAGCGTCTCGGCCGTAAAAAAGAAAAAAGCCGCCCCGAAAAGGCCTGACCTTCGGAAGAAGACCCAGAGTAAGCAGCGCCTTGCTGAAATCTTGCGTTCCGAATACGCAAGCGGGATGGAGGCTGGCATGGCCAAGGTCAGAAAGCAGAGCAAACAGGCCGACCAGGCAGCCGGCCGAGCGGCACGTCCGAGACCCGAGCCCGGCCTGGGCCGTGGGAAAAAGCAAAAGAAAAAACGCTCTCCGTGAAGGAGAGAAACCCAGAAAGGCTTACGAGGGACGAGACTCCCCAGAAAGTTGCTCTAAACTCTTCCTCCCCAGGACCGGGCCTGTGGCCCTGGTGGCACTGGATCGATGTCCCGCTCTCTTTTCAGAGGAGCCTTGGGACACGTACCAGTGCCACCTGTCCCTGATGACGGGCGTCCCTGCCACAGAGCGGCCACGGCCCCGTCTCCCACGGGGAGGGGTCAGCGGGGCAGGGAGTCAGTGGTTAGCCTGTGTCTTACAGCAGACACCTCACATCTTGTGTTCATTCTGTCAGCGCCCACACCTGCTTCACCCGTAGATCAGATGGTGCCCCCACGACTTAGTGCCTAAGCCTTGTCCTTACGTCAGCCAGGAGAGGCTGCGACCTGCCTGGTGACACGATCTGAAGAAATGTCTGTGTTCCTTTCTCCCGCCCCATCAGCGCCCATATGGGCGTGAATTTTGTAAAGTAAGATATCAAACTCCGGACTTCAATTTGTCAAAGAAGAAAATATTTATCAGATCACCTTCTCGATGTCTAAATGCTCGTGAGAGAGGATGGAAGGGGTTCGGGTGTGAGTCCCCGCGGTCAGCCCTCCTGGTTCCCGTCCGGGCTGCCCCCACCTCCAGACCACATGCGCAGGCATTGCTGGTGCCCCCCACATCCACGGAAAACTGATGCTCAGGACTAATTGACTTGCTGTCGCCGTTTTATCATTCGCCTTTGAAGTCAAAGGCTCCAGTGTCCTGAGCTTTTTCTCTCATGGAATCCGGTCCCCTCCAAGAAAGGCCTGAGGTCTTTGTACTGTGGCCCAGGCCACAGCTGCCCCGCCCCCATTGTGTTTCCTGGGAAGTTTGAAAGGGACCCCCAGGGCGTATTGATTTCCCAATAAATGTAAGATTTGGACACGGGTGACCGCAGAGGGTGCGGGGAGGTGGGGGGAGGGGGCGG