Transcript asmbl_49680

Sequence
Transcript Sequence for observation asmbl_49680 of TGE0001056:
GCTGGAGCAACGCGCTTGGAGGCGGGAGTGATCTGCGAGCGAAACCTACACCATGAGTCTCCTCAATAAACCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGAGGAATTCAACACAGGTCCCCTCTCAGTGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAACAAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCCCAAGAGCGGCAAGGGCAAGAAGAAATCCAAGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTGCTGCGGAACCCACTCATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCCTGCCCAGTGGGCGAGAAATAAAACCCTGTGCTTTTTGGTTTTTA