Transcript asmbl_49267

Sequence
Transcript Sequence for observation asmbl_49267 of TGE0009200:
AAGGCCCTGTGCGCCAAGGCCAGGTCAGGAATTGGGCTGGGCTGGCCTGGCTGTGGTGACCCTGGTCTTCTCCTGTCTCCAGAGAAATCTTGGTAGAAGAGAGCAACGTGCAGAGGGTGGACTCGCCAGTCACAGTATGCGGTGACATCCATGGACAATTCTATGACCTCAAGGAGCTGTTCAGAGTAGGTGGCGATGTCCCTGAGACCAACTACCTCTTCATGGGAGACTTTGTGGACCGTGGTTTCTACAGTGTTGAAACCTTCCTCCTCCTGCTGGCTCTTAAGGTTCGCTATCCTGACAGAATCACTTTGATCCGGGGCAATCATGAGAGTCGCCAGATTACCCAGGTCTATGGGTTCTATGATGAGTGCTTACGGAAATATGGTTCAGTGACTGTATGGCGCTACTGTACTGAGATCTTTGACTACCTCAGCCTGTCTGCCATCATTGATGGCAAGATCTTCTGTGTGCATGGAGGTCTTTCCCCTTCCATCCAGACCTTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTACCCCATGATGGACCCATGTGCGACCTCCTGTGGTCTGACCCTGAAGACACAACAGGCTGGGGAGTGAGCCCCCGCGGGGCAGGTTACCTGTTTGGCAGTGACGTGGTCGCCCAGTTCAATGCAGCCAACGACATTGATATGATCTGCCGTGCCCACCAATTAGTGATGGAAGGCTACAAGTGGCACTTCAATGAGACCGTGCTTACTGTGTGGTCAGCGCCTAATTACTGCTACCGCTGTGGCAATGTGGCAGCCATCTTAGAACTGGATGAGCACCTCCAGAAAGATTTCATCATCTTCGAGGCTGCACCCCAAGAGACACGTGGCATCCCCTCCAAAAAGCCAGTGGCCGACTATTTCCTGTGACTCCTTGGCCCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTGCCCAGTCGGAGGCTGGGTCTGAGGGGCTGCCTGGCTTTGCTTGCCCCAGGGTGCGGACTTGCTCTGGAGAGGTGGAGCCTTGGCTCCTGGCTTCCTCTCCTTTCTCCCACTTGATCCATGAAGTTTTCAGTCATTTTTTTTTTCTTTTTTCCTTTTTTTT