Transcript asmbl_47673

Sequence
Transcript Sequence for observation asmbl_47673 of TGE0005878:
AGGGCACACACTGGCCCCGGTGCCCACCCGCACCCCACCCCCAGAGCGCTGACTCGGCTCCCCGGACCTCGGCAGGATGGAAGAGAAGCTGAAGAAAACCAAGATCATCTTTGTGGTGGGCGGGCCCGGCTCGGGGAAGGGCACCCAGTGTGAGAAGATTGTCCAGAAGTACGGCTATACTCACCTTTCCACCGGGGACCTCCTGCGGGCCGAGGTCAGCTCGGGCTCGGCCAGGGGCAAGATGCTGTCGGAAATCATGGAGAAGGGGCAGCTGGTGCCGCTGGAGACAGTGTTGGACATGCTCCGAGATGCCATGGTAGCCAAGGTAGACATTTCCAAAGGCTTCCTGATCGATGGCTACCCTCGGGAGGTGCAACAGGGGGAAGAGTTTGAGCAGAGGATCGGACAGCCCACGCTGCTGCTGTATGTGGACGCAGGCCCCGAGACCATGACCAAGCGGCTCCTGAAGCGGGGAGAGACCAGCGGGCGTGTGGACGACAACGAGGAGACCATCAAGAAGCGGCTGGACACCTACTACAAGGCCACAGAACCTGTCATTGCCTTCTATGAGAAACGTGGCATCGTGCGTAAGGTCAATGCCGAAGGCTCCGTGGACAGTGTCTTCTCCCAGGTCTGCACCCACCTAGACGCCCTCAAGTAGCAGCGCCGGAGCCCCTTCCCCAGCTCAGAGCCCCACCCCACCCCTGTCCTGACTCAAGAACCCTGGCCTGAGCTCAGCGCCTCCGCCCTGCCCGCTGGAGCACAGACAGAGGAAGCCACTTTATCCTGTTTTCATGGACAGCTGAGCACTAAAGGAATTTCCGAGGACATTCGGTTTTACTCCTTTTTCTTTGCTTCCATCGGGGTTGATTCATGTGGGGTGGCCGCCCTGGCCTCGAGCCCCTCACCCTCCCCATTCCTCCTCAGGTCCCTCAGCCCACCTTGGCCGGCCGCCCCTCCCCAGTAGAAGGTCCCCTTCCTCACACAGGGTGTGCCGAGCTCAGACTGGGCCAGGCCTGGGGAGCCAGGGTCCTTGCTTTCTGGGACTCGTGGTCAGACAGAGCTGGGCCCTGGCCTGGATTCCTCTGCATTCTTGCTGTGTGGACTTGGCCCTGACCCCTCCTGTCTCTGAGCCCGTTTTCTGTGCCTAACCTCCTCTGGGGACTGAGCCATAGCAGGCAACAAGGTCATGGGCAGCGTGGGGCTCCCTGGTGGTGGGGGCAGCACACGTCGGCAAGCCAGGTGGGCAGGAAATTGGCCACCTTGGTACAAGAAGCCCCGAGGGTCTGAAAAGGACATCAAGAGTGAATGGGGGGAAGGGGTCAAGGTCAGGAGAGCCTCCCCGAGGAGGTGAGACCTGAAAGTCTTCCCACCA