Transcript asmbl_47669

Sequence
Transcript Sequence for observation asmbl_47669 of TGE0005877:
CAGAGAAAACTAGGAAGATCCTGACGGAGTTCCTTCGTTTTTACGAGGACCAGTATGGTGTCGCCCTTTTCAACAGCATGCGCCACGAAATCGAGGGCACCGGGGTGCCGCAGGCCCAGCTGCTCTGGCGCAAGGTGCCGCTGGATGAGCGCATCATCTTCTCGGGGAACCTCTTCCAGCACCAGGAGGACAACAAGAAGTGGAGGAACCGCTTCAGCCTCGTGCCCCACAACTATGGGCTGGTTCTCTACGAGAACAAAGTGGCGTATGAGCGGCAGGTCCCACCCCGAGCTGTCATCAACAGCGCAGGCTACAAAATCCTCACATCCGTGGACCAGTACCTGGAGCTCGTTGGCAACTCCTTACCAGGGACCACCTCGAAATCGGGCTCCGCCCCCATCCTCAAGTGCCCCACGCAGTTCCCACTCATCCTCTGGCATCCTTCTGCACGACACTACTACTTCTGCATGATGACAGAAGCCGAGCAGGACAAGTGGCAGGCTGTCCTGCAGGACTGCATCCGGCACTGCAACAACGGGATCCCCGAGGACTCCAAGGTGGAGGGCCCTGCGTTCACGGACGCCATTCGCATGTACCGCCAGTCGAAGGAGCTGTATGGCACCTGGGAGATGCTGTGTGGCAACGAGGTGCAGATCCTGAGCAACCTGGTGATGGAGGAGCTGGGCCCTGAGCTGAAGGCGGAACTTGGCCCCCGGCTGAAGGGGAAACCACAGGAGCGGCAGCGGCAGTGGATCCAGATCTCGGATGCTGTGTACCGCATGGTGTACGAGCAGGCCGCAGCGCAGTTTGAGGCGGTGCTGTCCAAGCTGCAGCTGGCCCGGCCGGCCATGGAGGCGGTCATCCGCACCGACATGGACCAGATCATCACCTCCAAGGAGCATCTGGCCAGCAAGATCCGAGCCTTCATTCTCCCCAAGGCGGAGGTGTGTGTCCGGAACCACGTTCAGCCCTACATCCCGTCCATCCTGGAGGCCCTCATGGTGCCCACCAGCCAGGGCTTCACGGAGGTGCGGGACGTCTTCTTCAAGGAGGTCACCGACATAAACCTGAACATCATCAATGAGGGCGGCATCGACAAGCTGGGCGAGTACATGGAGAAGCTGTCCCAGCTGGCGTACCACCCCCTCAAGATGCAGAGCTGCTACGAGAAGATGGAGCCGCTGCGGCTTGATGGTCTGCAGCAGCGTTTCGACGTGTCCAGCACGTCCGTGTTCAAGCAGCGAGCCCAGATCCATATGCGTGAGCAAATGGACAATGCCGTGTACACCTTCGAGACCCTCCTGCACCAGGAGCTGGGGAAGGGGCCCACCAAGGAGGAGCTGTGCAAGTCCATCCAGAGGATCCTGGAGCGGGTGCTGAAGAAATATGACTATGACAGCAGCTCTGTGCGGAAGCGCTTCTTCCGAGAGGCATTGCTGCAGATCACGATCCCATTCTTGCTCAAGAAGCTGGCCCCCACCTGCAAGTCGGAGCTGCCCCGGTTCCAGGAGCTGATCTTCGAGGACTTCGCCAGGTTCATCCTGGTGGAGAACACGTACGAGGAGGTGGTGCTGCAGACGGTCATGAAGGACATCCTGCAGGCCGTGAAGGAGGCCGCTGTGCAGAGGAAGCACAACCTGTACCGGGACAGCATGGTCATGCACAACAGCGACCCCAACCTGCACCTGCTGGCCGAAGGCACGCCCATTGACTGGGGTGAGGAGTATGGCGATGGTGGTGGCAGTGGCGGCAGCAGTGGGAACAGCGGTGATCCCAGCCCCAGTGTCCCAGAAGCAGCCACCACCTCAGAGAAACAACGGCGTGCCAAGCAGGTGGTGTCCATGGTCCATGACGAGGCAGGGCTGCCCTTTGAGGCTGGCCCTGAGCTACTATCACCTGCATCCCTGGACAGTGTCACCGAGCTCCGTGGCCTGCTGGCCCAGGATCTGCGGGCTGAGAGCCCCCCGCCGGCCGGACCCCTGCTCAACGGGGCCCCTCTGCGGGAGAGCTCCCAGCCTGTGGCCACCCCCGAGGCCTCACCACCTGCCTCGCCCCTCCGGCAGCTCCCGCCTGGAAAGGCTGTGGACCTTGAACCTCCCAAGCCCAGTGACCAGGAGACCGGGGAGCAGGTGTCTAGCCCTGGTGGCCGCCCTGCCATCCACACTACCACCGAGGACAGTGCGGGGGTGCAGACTGAATTCTAGGCTGGTCGCCCCCGAGCTTCTGTTGGACAAGGCACATGGGCCCCTCCCTCCAAGGCACTGGCAGGCTTGGCTCCAGGCGGGAGTGCCAGATCTGTGTCTCCGGGTGGAGGTGGGGCAGGGCTAGTATGCGTCTGGGGCTGGGCAGGGACGGCCCACCTGAGTCACTTTATTGGGTTCGGTCATACTTTGTTGCTCCGTTTTCTTTTCTGTGGGCTGATCTCAGCTTTCCTCCTTGTGCTGGGGGCTGAGCAGAGATGAGGGGGCTGGGAAGCTCTCAGTGGCCCCGATTCTCTGGGTCCTCCCTTCCTGCCCTTCCTCCGTGGCCTGCCTCCCTCGTGGGTCTTGCCATCCTTGCAGAGGGAGGTAAAGGCTTTGTCTGCTGTGACTCAGCCCTTGAATTCTCTGCCCTCGCCAAGGGCTCATTGGAACTGGGAACATGTAGCGCTGAGGCCCATCTTGGTCGCACTCCCCTCCTGCTCTCCCTGGCTGGGCCCACTGGCCAGTGTCAGAGTGGACACTGGCCTCACCTTTCCGATCCCGGGTGAGGGGAGGTTCAAGGAGGGGGTCTTCGGGCTAGAGTCAGGC