Transcript asmbl_47659

Sequence
Transcript Sequence for observation asmbl_47659 of TGE0005876:
CAGACATCAGAGACCTACTGAATTCAGGATTTCGTGAGTGAGAACTGTCAGTAATCTCGGTGCGTTCCCGTCCTTCGGCCTGTGGCTGGATTGCTTGCGACGTCCTATCTACCTGCCTGCTGACTGACTGGCCGACAGCTCCGGCAAGATGAAGCTCTCCCTGGTGGCTGCGGTGCTGCTGCTGCTCGGCGCGGCGCGGGCCGAGGAGGAGGACAAGAAAGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCCTGCGTCGGGGTGTTCAAGAATGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGCATCACGCCGTCTTATGTGGCCTTCACTCCCGAAGGGGAGCGTCTCATCGGGGATGCAGCCAAGAACCAGCTCACGTCCAACCCTGAGAATACGGTCTTCGACGCCAAGCGGCTCATTGGCCGTACTTGGAACGACCCGTCTGTGCAGCAGGACATCAAGTTTTTGCCTTTCAAGGTGGTTGAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGCCAAACAAAGACATTTGCTCCTGAGGAAATTTCCGCCATGGTTCTCACTAAAATGAAGGAAACTGCTGAGGCTTATTTGGGAAAGAAGGTTACTCATGCAGTTGTTACTGTACCGGCCTATTTCAATGATGCCCAACGCCAGGCAACCAAAGATGCTGGAACTATTGCTGGATTGAATGTTATGAGAATCATCAATGAGCCTACAGCAGCTGCTATTGCTTATGGCCTAGATAAGAGAGAAGGGGAGAAGAACATCTTGGTGTTCGACCTGGGTGGTGGAACCTTCGATGTGTCTCTTCTCACCATTGATAATGGTGTCTTCGAAGTTGTGGCTACTAATGGAGATACCCATCTGGGTGGAGAAGACTTTGACCAGCGTGTCATGGAACACTTCATCAAGCTCTACAAAAAGAAGACTGGCAAAGATGTTAGGAAAGACAACAGAGCTGTGCAGAAACTCCGGCGGGAGGTAGAAAAGGCCAAACGGGCCCTGTCTTCTCAACATCAAGCAAGAATTGAAATTGAGTCCTTCTTTGAAGGAGAAGACTTCTCTGAGACCTTGACTCGAGCCAAATTTGAAGAACTAAACATGGACCTGTTCCGTTCTACCATGAAGCCTGTCCAGAAAGTGCTGGAAGATTCTGATTTGAAGAAATCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCTACTCGAATCCCAAAGATCCAACAACTGGTTAAAGAGTTCTTCAATGGCAAGGAGCCATCCCGTGGCATAAACCCAGATGAGGCTGTGGCATATGGTGCTGCTGTCCAGGCTGGTGTACTGTCTGGTGATCAAGATACAGGTGATCTGGTACTGCTTGACGTATGTCCGCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCCAGGAACACTGTGGTGCCCACCAAGAAGTCACAGATCTTTTCTACAGCTTCCGATAATCAACCAACTGTTACAATCAAAGTTTATGAAGGTGAACGACCCCTGACAAAAGACAATCATCTTCTGGGAACTTTTGATCTGACTGGAATCCCTCCTGCTCCCCGTGGAGTCCCACAGATTGAAGTCACTTTTGAGATAGATGTGAATGGCATTCTTCGAGTGACAGCTGAAGACAAAGGTACAGGCAACAAAAATAAGATCACAATTACCAATGACCAAAATCGCCTGACACCCGAAGAGATTGAAAGGATGGTTAATGATGCTGAAAAGTTTGCAGAGGAAGATAAAAAGCTCAAGGAGCGCATTGATACTAGAAATGAATTAGAAAGTTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAAAAGCTGGGGGGCAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCCGTAGAGGAAAAGATTGAATGGCTGGAAAGTCACCAAGATGCTGACATTGAAGATTTCAAAGCTAAAAAGAAGGAACTAGAAGAAATTGTTCAGCCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCTCCCCCAACTGGAGATGAGGAACCAGTAGACAAAGATGAGTTGTAGACACTGCTCTGCTAGTGCTATGATGTTGTAAATACTGGACTCAGGAACTTTCGTTAGGAGAAAATTGAGAGAACTTAAGTCTCGAATGTAATTGGAATCTTCACCTTGGAGTGGAGTTGAAAATGCTATAGCCCAAGTGGCTGTTTACTGCTTTTCGTTAGCAGTTGCTCACATGTCCTGGGGTGGGGGGACAGGAAGAATTGGCTATCTTAAAAAGTGGGTAAAAAGGTTGGGTTACGGCATGTGTTCACCATGGAAAAATGTTCTATTTAACATTTGGGTCATGTGCATCTGGTGTAGGAACTTTATTTTCTACCGTAAGTGACATCAATAAATGTTTGTTATTTA