Transcript asmbl_4697

Sequence
Transcript Sequence for observation asmbl_4697 of TGE0001085:
GCTCGCGATAACTGCGCAAGCGCAGCCCGTACTTCCTTTTCCGAGTAACCGCCAAGATGGCCGAAGTGGAGCAGAAGAAGAAGCGCACCTTCCGCAAGTTCACCTACCGTGGCGTAGACCTCGACCAACTGCTCGACATGTCCTATGAGCAACTGATGCAGCTGTACAGCGCCCGCCAGAGGAGGCGCCTGAACCGTGGTCTTCGGCGGAAGCAACACTCACTGCTCAAGCGCTTGAGAAAGGCCAAAAAGGAGGCACCACCCATGGAGAAGCCTGAGGTGGTGAAGACGCACCTGAGGGACATGATCATCCTGCCGGAGATGGTGGGTAGCATGGTGGGCGTGTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAACCAGAGATGATCGGCCACTACCTGGGCGAGTTCTCCATCACCTACAAACCCGTGAAGCACGGCCGGCCCGGGATCGGTGCCACCCACTCCTCCCGATTCATCCCCCTCAAGTAGCCGAGGCCAATAAAGACTGGTTTTGGTCCCTGGA