Transcript asmbl_46934

Sequence
Transcript Sequence for observation asmbl_46934 of TGE0005867:
GTGTGGTACTAATATCTATATTTTTAGAGCTGGTGTTGATAAAAAATACTCTTATCAATCAGTTCTGACAATTTTTATTAAGAAAAACTTAAAACTTTTTTCAGATGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCAGTGTGAACGAGGTGGAGCTGCTGGTGATGAAGGCGCTCTCGGTGGGGCTGGTGAAAGGGAGCATCGACGAGGTGGACGGGCGGGTCCACATGACCTGGGTGCAGCCCCGCGTGCTGGATCTGCAGCAGATCGCGGGCATGCGGGACCGCCTGGGCTTCTGGTGCAGCGACGTGAAGAGCATGGAGATGCTGGTGGAGCACCAGGCCCACGACATCCTCACTTAGCGCCTGCCTGCGGAGCTGCCTCCTGGCTGACGAAGCTGGCGGCTGGGTCTTCATTTAAGTGGGGTGGGGTGGGGCGGGGATTCTGTTTGGAGTAGGGACTGTTCTTGCTGTGAAAACAGGACTGTCATTGATGGGGGCCTGGTCACATGGAGAAGCCTCCTTGGTGGGTGTCTCCTGTCACCTACACTGGGGAAGAGTCACCGCATCTTAGGTGGTGAGGCAAGCACGTGTGTGGGGACACCCGCTCTAAGGCTGGTTTCTGTCCATCCCCCTGCTGCATGAGCGCTCAGTTCTGTAATAAACGCCTTTGCTTTGTCCCGTC