Transcript asmbl_46417

Sequence
Transcript Sequence for observation asmbl_46417 of TGE0034453:
CCGGACGCAGCTAGGCTGTACAGACGCGGGCACGCACACCAGCACGCACGCCCTCCTCTCGTGCGGCCGCGGTCGTTCCCGCGTCCACCAGCAGCGCTGTCGCTTCGGCAGAAATGCTGCGGGCCTGTCAGTTATCCGGCGTGACCGTCGCGGCCCAGAGTTGTCTGTGTGGGAAGTTCGTCCTCCGTCCACTACGACCATGCCGTAGATACTCCACTTCAAGCAGTTCTGGGTTGACTGCTGGTAAGATTGCTGGAGCTGGCCTTTTGTTCGTTGGTGGAGGGATTGGTGGCACTATCCTGTATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATCCCTTACTCAGACAAACTCTTTGGGATGGTTCTTGGTTCTGCGCCTTATACTGTTCCATTACCAAAGAAACCGGTTCAGTCTGGTCCACTAAAAATCTCCAGTGTATCAGAGGTGATGAAAGACTCCAAACTGCCTGTGGCACAGAGCCAGAAAACGAAGGGAGACACTCCAGCTTCAGCAGCAGGTGATACACTTTCGGTCCCGGCCCCTGCAGTTCAGCATGAGGACACTATAAAAACCGAATGTCCCAACACTAATGAAGGAAAATCTACGTCTGAAACCACAGCTCTAGCCAAGAGTTTAGAAGATGCTCTGAACCGGACTTCGTCTGTCACTCTGCAGACTATTACAGCCCAGAATGCTGCAGTTCAGGCTGTCAAGGCACACTCCAACATACTGAAAACAGCCATGGACAATTCTGAGATTGCAGGTGAGAAGAAGTCGGCCCAGTGGCGAACAGTGGAGGGTGCATTGAAGGAGCGAAGAAAGGCAGTTGATGAAGCTGCCGATGCCCTGCTCAAAGCAAAAGAAGAGTTAGAGAAGATGAAAACTATAATTGAAGATGCAAAGAAAAGAGAGATTGCTGGAGCCACCCCTCATATAACTGCTGCAGAGGGGAGACTTCACAACATGATAGTTGATCTGGATAACGTCGTCAAAAAGGTCCAGGCTGCTCAGTCAGAGGCAAAGGTGGTATCTCAGTATCATGAACTTGTGGTCCAAGCAAGAGATGACTTTAGAAAAGAGCTGGACAGTATCACTCCAGACATCACTCCTGGATGGAAAGGGATGAGTAAGTACAACTGATTCTGGCAAACTCTCTACTGATGACCTGAACTCACTCATTGCTCATGCCCATCGTCGCATTGATCAGCTCAACAGAGAGCTAGCACAACAGAAAGCCACAGAGAAGCAGCACATTGAGCTAGCCTTGGAAAAGCACAAGCTAGAAGAAAAGCGGACCTTTGACTCTGCAGTGGCAAAAGCATTGGAGCACCACAGAAGTGAAATTCAGGCTGAGCAGGACAGAAAGGTAGAAGAAGTCAGAGATGCCATGGAGAATGAAATGCGGACCCAACTTCGACGGCAGGCAGCTGCCCACACTGATCATTTACGAGATGTCCTCAAGGTGCAGGAACAGGAACTGAAGTATGAATTTGAACAGGGCCTGTCTGAGAAACTGTCTGAGCAAGAATTAGAGTTTCGTCGTCGCAGTCAAGAACAAATGGACAGCTTTACTCTGGACATAAATACTGCCTATGCCAGGTTGAGAGGGATTGAGCAGGCTGTTCAGAGTCATGCAGTTGCTGAAGAAGAAGCCAGAAAAGCCCACCAGCTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAATGCCTACCATCCCATTGGGGAGTGCAGTTGAGGCCATCAGAGTCAACTGTTCTGATAATGAATTTACCCAGGCTTTAACTGCAGCCATTCCTCCAGAGTCCCTGACCCGGGGGGTATACAGTGAAGAGACCCTAAGAGCCCGTTTCTATGCTGTTCAAAAACTAGCCCGAAGGGTAGCGATGATTGACGAAACCAGAAATAGCCTGTACCAATACTTCCTTTCCTACTTACAGTCCCTACTCCTGTTCCCGCCTAAGCAACTGAAGCCCCCGGCGGAGCTCTACCCTGAAGATATAAATACATTTAAATTGCTCTCATATGCCTCCTATTGTATTGAGCATGGTGACCTGGAGCTGGCAGCAAAGTTTGTCAATCAGCTCAAAGGGGAGTCCAGAAGAGTGGCACAGGACTGGCTGAAGGAGGCCCGAATGACCCTAGAAACTAAGCAGATAGTGGAGATCCTGACTGCATACGCCAGCGCCGTAGGAATAGGAACCACTCAAGTGCAGCAAGAGTAAGGCCTAGGAAGAGTTGTGTAATGTCATATTTCATATCAAAGAAAATCAGCATTGGTATCTGCAGGGTTTGCAACAAGGGTCCCAGAATTGTCCAGAAGTGAGCAGGTTCCAAGTCCTGTGTGAGATGTTAACACCTGTTGCATTTACCGTCCTTACACTGCTATCATGCCAATGAACTCCAGGAGGCTTTATTTGCAACTTGTGTAACACTTCCTGTTTTTTAGGTTTTACTGATCAGGCTTGTGAGCCACTCAAAATAATGTTTGTGATCCCTACTATTGATTCTGCCCTTGGAGCAAACTGAATAAAGCAACACAATGAAAA