Transcript asmbl_46354

Sequence
Transcript Sequence for observation asmbl_46354 of TGE0002528:
TCGCGCAGTTTGAAATAACGCCGTCGGGAGGGGCTTAGGCCGGCGCTGGGGCGTGCGGCCCTCTCCACCCAAGCGTGCTCTCTGCAGCTACGCCTTTGCCAAGCCCGTCCGCACAAATATTCTCGAACCACACAAATATTTCTACACGTCCCAAAGGGGTTCTCACTCGGTCCCTCCCAGAAGGACTTTTAGTCCAAGTACCACCCCGGATGCCACAAGCCTTGGGATCCCGCGCCTAGTGAGAGGTGGTGCTTAAAGAACCCCGCTGTTTATCTCCCCGGCCTTCAAGATCCGGGCAAGGAGGTGGGTGGAGCCCCGCTTTGGCGCGCTCCGAGACGCAGAGAGGCCTCCGCGGTCCTTCCTGCCCGCCTTCCCCCCCCTCCCCCCAGCCAGGAGACCCCCTGGGCGCCACGCCGCGGACGGTGAGCATTGCGCGCGCCGCCCCCCGCAGGACGCGTTCCCGGCGGGCCCCGCGCGGCCAGGGCGTGGGCGGTGCTCCCCCTCCCCCCCGGCGGAGCTGCCCGCGCCCCCTCCCCTCGGATGTGGCTGAACCGAAGCGCGCAGGCGGGAGACTCTGCAGGATCCGCGGCCCTGAGCATCGGAGCGGTGAACTCTTCAAGTCTCCGATTAAATTTAAAAAATGGCCTCCAATAAAACTACATTGCAAAAAATGGGAAAGAAACAAAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTGGTAGAAAAAGTACTGGACCGTCGTGTAGTGAATGGGAAGGTGGAGTATTTCCTGAAGTGGAAGGGGTTCACAGATGCTGATAATACTTGGGAACCAGAAGAAAATTTAGATTGTCCAGAATTAATTGAAGCATTTCTTAATTCTCAAAAAGCTGGTAAAGAAAAAGATGGTACAAAAAGGAAATCTTTATCTGACAGTGAATCTGATGATAGCAAATCGAAGAAGAAGAGAGATGCTGCTGACAAACCAAGGGGCTTTGCCAGAGGTCTCGACCCTGAACGAATAATCGGCGCCACAGACAGCAGCGGAGAGTTAATGTTTCTCATGAAGTGGAAGGACTCGGACGAGGCCGACTTGGTGCTGGCAAAGGAGGCGAACATGAAGTGTCCTCAGATTGTCATTGCCTTCTACGAGGAGCGGCTGACTTGGCATTCTTGTCCTGAAGATGAAGCACAATAATTGTTTGCATTTATATATATATATTTATATATA