Transcript asmbl_45801

Sequence
Transcript Sequence for observation asmbl_45801 of TGE0001766:
GCTTCCTGCGCTGATTGGATCCGTGGGCGAGGCGGAGGAGAGCCGTGCGCAGCGGCGTGTGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTGAAAATAAACAGCCGCTGCTTTGCGAGTCGCCTTCTTGGTTCTTCGTCCGAGTCTCCTCCGCTGTGGGCAGCTCAGACGCCGAAGCTCTAACTGCAGCTATGAGCAGCAACGAATGCTTCAAGTGTGGACGATCTGGCCACTGGGCCAGGGAGTGCCCTACTGGTGGAGGTCGGGGTCGTGGAATGAGAAGCCGCGGCAGAGGGTTCCAGTTTGTTTCCTCGTCTCTCCCTGACATCTGCTACCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTGCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGCTACAATTGTGGCAAGCCAGGCCATCTGGCTCGTGACTGTGACCACGCGGATGAGCAGAAGTGCTATTCTTGTGGTGAATTTGGACATATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAATTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCATCTTGCACGGGAATGCACAATTGAGGCTACAGCCTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGATAGAGGCTGTTCCCAGGCCAGTGAGCTTTACTTGCAGTGTAAAAGGAGGAAAGGGGTGGAAAAAACCGAATTTCTGCATTTAACTACAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGTGCCACTGGTGAATAGGGATTAATGAATGGGAAGAGTTCAGTCAGACCAGTAAGCCCTTCTGGGTTTGAGTGTGTTCCCATGTAGGAGGTAAAACCAATTCTGGAAGCATCTAAGCTTCCATAAATAACTTTAATTCTTAGCATAATGACGGCCTTGGATTGTCTGACCTCAGTAGCTATTAAATAACATCGAGTAACATCTGCATCAGGCCCTCAGAATATACAGTTGAGTTGGGAGTAAACTGAAAAGACAAATGTGTTGAAGGCTATGCCAGGGAATCTGGCTCAAAGCCTAACACAGAAGCAGCTTCATCCCAGTGACGATGCTGGACGTACAGATGGTGATGGCAAAGGTGTAGAACACATTTTTTCAAAGACTAAATCTAAAACCCAGAGTAAACATCCGATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAATGCATTTTCACAGAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTGTTTCATTTGCTGTAATCAGTTTTTAAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAAATGTAATTTTAAACTATTCCAATAAAGCTGGAGGAGGAAGGGGAGTTTTGACTAAAGTTCCTTTTGTTTGTTTTAAATTTTCATCAATGTATATAGAACAAAATACCATATTAAAGAGGGGAATGTGGAGGACTG