Transcript asmbl_46562

Sequence
Transcript Sequence for observation asmbl_46562 of TGE0005842:
GGCCTCACTGAGTGCTGCCGGGAGCCGCCACGCAGCCATGGAGGAGGAGGAGGAACAGCCACCTCAGGAGGCCCACGCAGAACCCCCTGTGACGTCAGGAGCGTCGGAGGTGGTGCCCAGGGTGCTTTCCGGAGAACCCCAGAACCTGTCTGACGTGGATGCTTTCAACCTGCTGCTGGAGATGAAGCTGAAGAGGCGGCGAGAACGGCCCCACCTGCCACGCACGGTGACAGAGCTGGTGGCCGAGGACGGGAGCAGAGTGTATGTGGTGGGCACAGCCCACTTCAGCGACGACAGCAAGAAGGACGTCGTGAAGACGATCCGGGCGGTGCAGCCGGACGTGGTGGTGGTGGAGCTCTGCCAGTACCGCGTGTCCATGCTGAAGATGGACGAGCGCACGCTGCTGCGGGAGGCCCGGGAGGTCAGCCTGGAGAAGCTGCAGCAGGCCGTGCGGCAGAACGGGGTCATGTCTGGACTCATGCAGATGCTGCTGCTGAAGGTGTCGGCCCACATCACCGAGCAGCTGGGCATGGCCCCTGGTGGCGAGTTCAGGGAGGCCTTCAAGGAGGCCAGCAAGGTGCCTTTCTGCAAGTTCCACTTGGGCGACCGGCCCATCCCCGTCACCTTCAAGAGGGCCATCGCCGCGCTGTCCTTCTGGCAGAAGGTCAAGCTGGCCTGGGGCCTGTGTTTCCTGTCAGACCCTATCAGCAAGGATGACGTGGAGCGATGCAAGCAGAAGGACCTGCTGGAGCAGATGATGGCGGAGATGGTCGGCGAGTTCCCCGACCTGCACCGCACCATCGTCTCCGAGCGCGACATCTACCTGACCTACATGCTGCGGCAGGCGGCCCGGCGCCTCGAGCTGCCGCGCTCCTCCGACGCTGAGCCCAGGAAGTGTGTCCCCTCTGTGGTGGTGGGCGTCGTGGGCATGGGCCACGTCCCCGGCATCGAGAAGAACTGGACCACTGACCTCAACATCCAGGAGATCATGACCGTCCCCCCGCCGTCCATCTCCGGCAGAGTGTCCCGGCTGGCTGTGAAGGTCGCCTTCTTGGGCCTGCTGGGCTATGGCCTGTACTGGATGGGGCGCCGCACCGCTGGCCTGGTCCTCTCGCTGCCTGCCACCCAGTACTGCCTGCAGAGGGCGTCCTCAGCCCGGCCGCACAAGTAGGAGGCGCACAGGGAGCCGCCACGCCTGAGGGGCCGTCCCCACGGGTCCGGGCCCAGCCTCGCCTGCCCTCCCCCAGCCCACCCAAATAAAGAATTATTTAACTGCTCTGAGCTCAGGCTCCCCAGCCCGCCCCCAGGGGCTGCTCACGGGTTCTCGGGCACCAGGACAGGCATCCGGGAGGGCCGAGGCCACGCTTCCCCGCCAGTCCCTCCCTGCCCTAGGTGGTCGGGCACGCTGGGCCACAGCCGGCAGTCCCCTCCCTCACTGTGCCTTCGGCTGTGCGTCAGCGCCTGGAGCGCCTGGCCTGGCGGCTTGGGCTGGGAGGGCGAGAGCACCCAGGCTCTGGCCTGGCCCCTGGGAGTAGTCCTCCCAGGGGAGCAGCTTGGCCAAGCCTGGCGGCCTGGCGGCCGGATGTGCACCAGCACCGCTCTGCCTGCAGAGGTGTGTGTTCTTGGCTTTTAAAAATATCTGAAATTTTTTACTCAGGTAACTTTAACTTAAACAAAGTGAAGCAATGTCAGGAAATACGAGCCTTAAATCTGGTTGGGACAGGGAGGACGGCTTTCCCTCGGGATCCCCGAGAGAATGAGCGTGCAGGCAGGTCCAGCCCTGGCACCAAGGGCCCCTCCAGCTGCCCCCGTGGCCTGCTTCCAGCTCCTGGGGGTCCAGCAGTGAGCCTGTCTGGATGCAGGGGTCACACCTACTGCTTGCGCATCTGGTCGGGAGACCTGCAGGTCTCCCCTACCCTCAGTGGACAGATGGTGTGTGTCCGCCAGGGCCCACCAGTTTGCACGTGTGCCTGCAGGCGCCCACCGCCCTCTCGTATGCCCACCTCAGGGTGCTGCAGACAGGAGCTCGAGGCCGGGCTGGCCCCTGGTCATTGCCCTGTGCACAGTCACCTGGTCCTGGTCGTCAGTTTAGGACGAGGCGTCCGCGTAGCCCAGCTGGGCCACGTTTGACTGTCTGCTGACTCGGTGTGTTACCAAATCAGGGGAAACCCACAGCCACGCAGGGCTAGGGAACCTCGGGCTGGACCATGTCCCTCCTGCCATTCATGTACTGTTCCTCAGAAACAAATAAAAGCTACTTTTGGAAGCTC