Transcript asmbl_45109

Sequence
Transcript Sequence for observation asmbl_45109 of TGE0004149:
CCCGGCCGGGCCGCTGCACTCCCGCGCGCGCATCCGTGCGCCGCCCGAGGCTGGCCTGAGGAGTCGGCGGCCATCTTGTTCTTCTCGTGGTTCCCAGTGGCGAGAGGAGGAGGAAGCCCGGAGCGGAGCGGGGCGGCTGGGGGGGGTGGACCCGCCGCGGCTGCTGCTGCCACCGCCGCCGCCGCCACCACCGCTCGTGGGGCTCGTGGCGTGAGGAAGGAGGACGAGTGAGACCCCGGGGCGAGCGGGCGGCGGCGCCGCTGCTGCTGCTGCTGCTGCGGGAGGGTCGGCGGCGGGACGGCGATGGCGGATATCGACAAACTCAACATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCAGGCAAGAATGTCCAGCTCCAGGAGAACGAGATCCGAGGACTCTGCCTGAAGTCTCGGGAGATCTTCCTCAGTCAGCCTATCCTTTTAGAACTTGAAGCACCACTCAAGATATGTGGTGACATCCACGGGCAGTACTATGATTTGCTCCGTCTGTTTGAATACGGTGGCTTTCCTCCAGAGAGCAACTATTTGTTTCTCGGGGACTATGTGGACAGGGGCAAGCAGTCCCTGGAGACAATCTGCCTCTTGCTGGCCTACAAAATCAAGTATCCGGAGAACTTCTTTCTTCTCAGAGGGAACCACGAGTGCGCCAGCATCAATAGGATCTACGGATTTTATGATGAGTGTAAAAGAAGATACAACATTAAGCTGTGGAAAACGTTCACAGACTGTTTTAACTGCTTGCCGATAGCAGCCATCGTGGACGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGAGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGCTATGAGTTTTTTGCAAAGAGGCAGTTAGTCACTCTGTTTTCTGCACCCAACTACTGTGGCGAGTTTGACAATGCAGGCGCCATGATGAGTGTGGATGAGACCCTCATGTGTTCCTTCCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCCAACGCCACGAGACCTGTCACACCACCACGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCACTTGACACTGCCTGGTTGGGACTTGTAACATAGCGTTCATAACCTTCCTTTTTAAACTGTGATGTGCTGGTCAGCTTGCCCAGGTAGACCTGTCTGTCGGGCCCTCCTCCATTTGATTACTGCTGGCACTTGCTGGTTATAGCAGCAAGCCAAGCACTTCATTCTCAAGAGAGCATTTTGTTTTGAACCTCTGTTCCCTTTGTGGACAGCTCTGATGATGGTGTTAAGCTGTACACCCTGGCAGGTTATCCTGTCTGAGGAGAAAGTGTACAATTGATCTTTTTTTAATTTAGTATAAGTCATGAATAATGTAAATGCCTGTTTTCTTTAGGATATAAAGAGAGCCTTAGAGTGCGTGAGTCTCTACATGTAATTGTCATAAATGCATTCTGTTGATACAAACCACTGTGAACAATTTTTTTTCCAGTTTGTTTGAAAGGGACTGCTTTCCCTCATTGTCTTGTCATGTACAAACTAGTGTCTGCAGCTGTGGCAGCAGGAGTGACCTGCCTGCCGCCAGCCCTGCCCAGACTATCTGAAGCACACTCCTTCCCACTGCACATTTAATAATGATTAAAGCCATTCTTTTCAATGTCTGTGATTCCTTCCTAAAGCCAAAGTTTCTGTTGGACTGTATGGCACGCCCTGGGGATGAGGTGGCCAGGGCATCGAGGCTGCGTGCACAGGCCGCCTCCCTCCGTGGGGCCTCAGAAGCAGGTTATTTTAACTAGCAATAGTGGTATAGTGCTGAGTAAGCTATTAATGATGGAAGTTAATGACACTTTGTACAGTTCCCATATAGTCTATTCACTGAGTGATCTTTTTACAGTTGGATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAACACTGTCCTATACGAGTGACCGATAATGCTTTCTTTGGCTACATTCTTTATTCTGCGGTGACATTGAGGCTTATAAATCAAAAGGAACTAACTTGCCGTCCACCGGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAACTACGACCTGTTAAATGAATCTGTTTGCACAGATGCCCGTGTACAATGCCATGTGCTGAGAATGGTTTCAGACTTATTAAATGCAAGCTTGTTAA